Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634686_at:

>probe:Drosophila_2:1634686_at:120:309; Interrogation_Position=1236; Antisense; CCACGGAGCTGGTGTACCTGGGCCA
>probe:Drosophila_2:1634686_at:21:709; Interrogation_Position=1295; Antisense; TTCAACTACCACACTGGAGGAGCCG
>probe:Drosophila_2:1634686_at:673:509; Interrogation_Position=1355; Antisense; GTGCAGCGCTGCAGTTGTCCCAGTG
>probe:Drosophila_2:1634686_at:495:409; Interrogation_Position=1391; Antisense; GACGACATGATCCTGGGCTACTGCC
>probe:Drosophila_2:1634686_at:551:325; Interrogation_Position=1436; Antisense; GCGATACACGTTGCCGGAATGCATC
>probe:Drosophila_2:1634686_at:300:233; Interrogation_Position=1453; Antisense; AATGCATCAGGCTAGGCCGCAGGAC
>probe:Drosophila_2:1634686_at:180:267; Interrogation_Position=1509; Antisense; CGCTGACCTTCCACAAGTTCTGGAA
>probe:Drosophila_2:1634686_at:713:213; Interrogation_Position=1523; Antisense; AAGTTCTGGAACACGGATCCGGAGC
>probe:Drosophila_2:1634686_at:435:583; Interrogation_Position=1562; Antisense; TGGCTCGGTGGCAGCATGGTCAACC
>probe:Drosophila_2:1634686_at:122:61; Interrogation_Position=1577; Antisense; ATGGTCAACCGAAGTGCCCCGCTGG
>probe:Drosophila_2:1634686_at:404:269; Interrogation_Position=1668; Antisense; CAGGCGTTGGATTGCTGCAGCAAAC
>probe:Drosophila_2:1634686_at:710:593; Interrogation_Position=1698; Antisense; TGGGCAAGCACCTGGATCTCTGAGC
>probe:Drosophila_2:1634686_at:279:39; Interrogation_Position=1713; Antisense; ATCTCTGAGCCGCTCTGAGGTGAGT
>probe:Drosophila_2:1634686_at:281:399; Interrogation_Position=1752; Antisense; GACACATCCAATGCAGTGCGGCACA

Paste this into a BLAST search page for me
CCACGGAGCTGGTGTACCTGGGCCATTCAACTACCACACTGGAGGAGCCGGTGCAGCGCTGCAGTTGTCCCAGTGGACGACATGATCCTGGGCTACTGCCGCGATACACGTTGCCGGAATGCATCAATGCATCAGGCTAGGCCGCAGGACCGCTGACCTTCCACAAGTTCTGGAAAAGTTCTGGAACACGGATCCGGAGCTGGCTCGGTGGCAGCATGGTCAACCATGGTCAACCGAAGTGCCCCGCTGGCAGGCGTTGGATTGCTGCAGCAAACTGGGCAAGCACCTGGATCTCTGAGCATCTCTGAGCCGCTCTGAGGTGAGTGACACATCCAATGCAGTGCGGCACA

Full Affymetrix probeset data:

Annotations for 1634686_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime