FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634687_at:

>probe:Drosophila_2:1634687_at:65:179; Interrogation_Position=107; Antisense; AAACTCTGGGACTCCTAGATGCCGA
>probe:Drosophila_2:1634687_at:216:65; Interrogation_Position=13; Antisense; ATGGGCAGAAACAATCGCTCGAGAA
>probe:Drosophila_2:1634687_at:538:245; Interrogation_Position=171; Antisense; AATTAAGACCGCCAAGGAGCTCAAA
>probe:Drosophila_2:1634687_at:475:419; Interrogation_Position=217; Antisense; GAGCAGGAATTGATCTACGAGCACC
>probe:Drosophila_2:1634687_at:126:453; Interrogation_Position=228; Antisense; GATCTACGAGCACCAGGAGAGTCTG
>probe:Drosophila_2:1634687_at:352:79; Interrogation_Position=272; Antisense; AGGTGACCAACGAGAACACGGGCGT
>probe:Drosophila_2:1634687_at:507:151; Interrogation_Position=287; Antisense; ACACGGGCGTGGAGCACATTTTCAA
>probe:Drosophila_2:1634687_at:518:355; Interrogation_Position=300; Antisense; GCACATTTTCAACAGCAAGACCCTC
>probe:Drosophila_2:1634687_at:432:211; Interrogation_Position=316; Antisense; AAGACCCTCAAAGATCAGTACGGCA
>probe:Drosophila_2:1634687_at:466:487; Interrogation_Position=333; Antisense; GTACGGCAATTATCCTGCGTGGTTC
>probe:Drosophila_2:1634687_at:113:115; Interrogation_Position=392; Antisense; AGCAGCACTCGCAGAAGAAGAACTT
>probe:Drosophila_2:1634687_at:193:377; Interrogation_Position=408; Antisense; GAAGAACTTCAAACAGGCCTGGACC
>probe:Drosophila_2:1634687_at:69:577; Interrogation_Position=427; Antisense; TGGACCACGGTTAATGTTCCCCTAT
>probe:Drosophila_2:1634687_at:262:379; Interrogation_Position=79; Antisense; GAAGCCAAGGAGTTAATTCGACTGA

Paste this into a BLAST search page for me
AAACTCTGGGACTCCTAGATGCCGAATGGGCAGAAACAATCGCTCGAGAAAATTAAGACCGCCAAGGAGCTCAAAGAGCAGGAATTGATCTACGAGCACCGATCTACGAGCACCAGGAGAGTCTGAGGTGACCAACGAGAACACGGGCGTACACGGGCGTGGAGCACATTTTCAAGCACATTTTCAACAGCAAGACCCTCAAGACCCTCAAAGATCAGTACGGCAGTACGGCAATTATCCTGCGTGGTTCAGCAGCACTCGCAGAAGAAGAACTTGAAGAACTTCAAACAGGCCTGGACCTGGACCACGGTTAATGTTCCCCTATGAAGCCAAGGAGTTAATTCGACTGA

Full Affymetrix probeset data:

Annotations for 1634687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720