FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634688_at:

>probe:Drosophila_2:1634688_at:473:715; Interrogation_Position=346; Antisense; TTCTGGGTCACAACTACAGTCTGGA
>probe:Drosophila_2:1634688_at:20:319; Interrogation_Position=411; Antisense; GCCGGAGCCTATTATCGCAATGCGA
>probe:Drosophila_2:1634688_at:498:3; Interrogation_Position=441; Antisense; ATTGTGGTCACCTACGACATGTCGA
>probe:Drosophila_2:1634688_at:102:373; Interrogation_Position=467; Antisense; GAAGGATTCGCTGGAGTCGGCAAAA
>probe:Drosophila_2:1634688_at:633:249; Interrogation_Position=527; Antisense; CAAGAGACCCTTGGTTTTCCTGGTG
>probe:Drosophila_2:1634688_at:636:591; Interrogation_Position=547; Antisense; TGGTGGGCACAAAAGCAGACCTCTT
>probe:Drosophila_2:1634688_at:218:365; Interrogation_Position=636; Antisense; GAATATTGGTCCGTTTCGGCGCGAT
>probe:Drosophila_2:1634688_at:668:639; Interrogation_Position=651; Antisense; TCGGCGCGATCTGGCTTCAAAGTTA
>probe:Drosophila_2:1634688_at:12:17; Interrogation_Position=680; Antisense; ATTATTCCAAAGGATCGCTGCCCTG
>probe:Drosophila_2:1634688_at:498:153; Interrogation_Position=761; Antisense; ACAGGCCACTCAGGCATCTGTTAAA
>probe:Drosophila_2:1634688_at:627:569; Interrogation_Position=797; Antisense; TGGTAAGCCGCTATTCGAAAATTCT
>probe:Drosophila_2:1634688_at:520:705; Interrogation_Position=856; Antisense; TTACGCAACTTCTTTGGAAGCCGCC
>probe:Drosophila_2:1634688_at:400:125; Interrogation_Position=874; Antisense; AGCCGCCTCTCGCAACAGAAAAGTG
>probe:Drosophila_2:1634688_at:692:221; Interrogation_Position=894; Antisense; AAGTGGCTGTACTTGCTAGCCTGCA

Paste this into a BLAST search page for me
TTCTGGGTCACAACTACAGTCTGGAGCCGGAGCCTATTATCGCAATGCGAATTGTGGTCACCTACGACATGTCGAGAAGGATTCGCTGGAGTCGGCAAAACAAGAGACCCTTGGTTTTCCTGGTGTGGTGGGCACAAAAGCAGACCTCTTGAATATTGGTCCGTTTCGGCGCGATTCGGCGCGATCTGGCTTCAAAGTTAATTATTCCAAAGGATCGCTGCCCTGACAGGCCACTCAGGCATCTGTTAAATGGTAAGCCGCTATTCGAAAATTCTTTACGCAACTTCTTTGGAAGCCGCCAGCCGCCTCTCGCAACAGAAAAGTGAAGTGGCTGTACTTGCTAGCCTGCA

Full Affymetrix probeset data:

Annotations for 1634688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720