Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634690_at:

>probe:Drosophila_2:1634690_at:456:451; Interrogation_Position=1813; Antisense; GATCGATAACATCTCGCTCATCTTT
>probe:Drosophila_2:1634690_at:314:3; Interrogation_Position=1847; Antisense; ATTGTGGGCTACTCCACACCAGATC
>probe:Drosophila_2:1634690_at:417:263; Interrogation_Position=1877; Antisense; CAGCATGCGATCTACACGGAAGTTT
>probe:Drosophila_2:1634690_at:334:139; Interrogation_Position=1892; Antisense; ACGGAAGTTTTCACCCAGAAGCAGG
>probe:Drosophila_2:1634690_at:311:319; Interrogation_Position=1939; Antisense; GCCCGTTTCGTTCTGGGAGCAATAT
>probe:Drosophila_2:1634690_at:285:211; Interrogation_Position=1981; Antisense; AAGAACACCGGCCACAGTTATCAAG
>probe:Drosophila_2:1634690_at:675:475; Interrogation_Position=1997; Antisense; GTTATCAAGCGGGTGCCAAGCAACA
>probe:Drosophila_2:1634690_at:456:231; Interrogation_Position=2024; Antisense; AATGACTTACTCTCGCTATATGCAA
>probe:Drosophila_2:1634690_at:148:341; Interrogation_Position=2038; Antisense; GCTATATGCAACTCCCTTCAAAGGA
>probe:Drosophila_2:1634690_at:541:565; Interrogation_Position=2063; Antisense; GGCACCATTAAGAAGCGGAAGTTTT
>probe:Drosophila_2:1634690_at:498:369; Interrogation_Position=2080; Antisense; GAAGTTTTACGGCACACCGCCGGCA
>probe:Drosophila_2:1634690_at:358:707; Interrogation_Position=2180; Antisense; TTGCAAGTTTTTTGTTTCCGGCCAG
>probe:Drosophila_2:1634690_at:600:95; Interrogation_Position=2203; Antisense; AGCCAACCCCGAGCTGTATTTGTAC
>probe:Drosophila_2:1634690_at:586:677; Interrogation_Position=2219; Antisense; TATTTGTACCCAACCCAACCATAAG

Paste this into a BLAST search page for me
GATCGATAACATCTCGCTCATCTTTATTGTGGGCTACTCCACACCAGATCCAGCATGCGATCTACACGGAAGTTTACGGAAGTTTTCACCCAGAAGCAGGGCCCGTTTCGTTCTGGGAGCAATATAAGAACACCGGCCACAGTTATCAAGGTTATCAAGCGGGTGCCAAGCAACAAATGACTTACTCTCGCTATATGCAAGCTATATGCAACTCCCTTCAAAGGAGGCACCATTAAGAAGCGGAAGTTTTGAAGTTTTACGGCACACCGCCGGCATTGCAAGTTTTTTGTTTCCGGCCAGAGCCAACCCCGAGCTGTATTTGTACTATTTGTACCCAACCCAACCATAAG

Full Affymetrix probeset data:

Annotations for 1634690_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime