FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634692_at:

>probe:Drosophila_2:1634692_at:551:181; Interrogation_Position=139; Antisense; AAAAACATGTCCTATTCCAGCCGAT
>probe:Drosophila_2:1634692_at:255:7; Interrogation_Position=152; Antisense; ATTCCAGCCGATTTGGTTTCGACTT
>probe:Drosophila_2:1634692_at:420:479; Interrogation_Position=167; Antisense; GTTTCGACTTCCATCTGCCGGATGA
>probe:Drosophila_2:1634692_at:375:65; Interrogation_Position=195; Antisense; ATGGTGCTACCCGAAGAACGACATG
>probe:Drosophila_2:1634692_at:624:381; Interrogation_Position=210; Antisense; GAACGACATGCATTTCATCCGCAGC
>probe:Drosophila_2:1634692_at:46:237; Interrogation_Position=283; Antisense; AATCCCAATGGCGTGATCTATCCGC
>probe:Drosophila_2:1634692_at:411:37; Interrogation_Position=298; Antisense; ATCTATCCGCGGGTGGTAGGCATGA
>probe:Drosophila_2:1634692_at:99:681; Interrogation_Position=314; Antisense; TAGGCATGATTCCACGCTACGGCGG
>probe:Drosophila_2:1634692_at:308:1; Interrogation_Position=342; Antisense; CGTTCCGGGCAACAAATTTCGTGTG
>probe:Drosophila_2:1634692_at:269:517; Interrogation_Position=362; Antisense; GTGTGGGCAACACCTATGGCCGTTC
>probe:Drosophila_2:1634692_at:1:647; Interrogation_Position=405; Antisense; TCATCTGGCCCTCAATCATGATTGA
>probe:Drosophila_2:1634692_at:164:703; Interrogation_Position=438; Antisense; TTATCGGAACACTCACTCACCATTA
>probe:Drosophila_2:1634692_at:256:651; Interrogation_Position=468; Antisense; TCAAATTCGCTGTGTTACGCTTACA
>probe:Drosophila_2:1634692_at:195:237; Interrogation_Position=508; Antisense; AATCGTATCCAGTAGAAGCCTGTAG

Paste this into a BLAST search page for me
AAAAACATGTCCTATTCCAGCCGATATTCCAGCCGATTTGGTTTCGACTTGTTTCGACTTCCATCTGCCGGATGAATGGTGCTACCCGAAGAACGACATGGAACGACATGCATTTCATCCGCAGCAATCCCAATGGCGTGATCTATCCGCATCTATCCGCGGGTGGTAGGCATGATAGGCATGATTCCACGCTACGGCGGCGTTCCGGGCAACAAATTTCGTGTGGTGTGGGCAACACCTATGGCCGTTCTCATCTGGCCCTCAATCATGATTGATTATCGGAACACTCACTCACCATTATCAAATTCGCTGTGTTACGCTTACAAATCGTATCCAGTAGAAGCCTGTAG

Full Affymetrix probeset data:

Annotations for 1634692_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720