Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634693_at:

>probe:Drosophila_2:1634693_at:352:231; Interrogation_Position=3413; Antisense; AATGAATCCAAGACCTTCCTACTGG
>probe:Drosophila_2:1634693_at:344:721; Interrogation_Position=3428; Antisense; TTCCTACTGGCCATGCAATCGGAGA
>probe:Drosophila_2:1634693_at:545:353; Interrogation_Position=3476; Antisense; GCAGCGCTTCAAAAGGCCGTGGATG
>probe:Drosophila_2:1634693_at:504:399; Interrogation_Position=3534; Antisense; GACAGGGTATCGATCGGCATTTGTT
>probe:Drosophila_2:1634693_at:692:307; Interrogation_Position=3614; Antisense; TCCAAGGGTTACGTCCGATCGGTGA
>probe:Drosophila_2:1634693_at:156:263; Interrogation_Position=3659; Antisense; CAGGTAGCCACCTCCAATGAAGGGT
>probe:Drosophila_2:1634693_at:504:79; Interrogation_Position=3679; Antisense; AGGGTTCATGGCATACGGACCACTT
>probe:Drosophila_2:1634693_at:338:555; Interrogation_Position=3695; Antisense; GGACCACTTCTATCCGACGGATATG
>probe:Drosophila_2:1634693_at:436:393; Interrogation_Position=3740; Antisense; GAAAGTAAGATCACCTTCGCCATCT
>probe:Drosophila_2:1634693_at:253:633; Interrogation_Position=3756; Antisense; TCGCCATCTCCGCTTGGAAAAGTTG
>probe:Drosophila_2:1634693_at:341:197; Interrogation_Position=3867; Antisense; AACGTGCGGGCGAACATCCATGTAA
>probe:Drosophila_2:1634693_at:245:499; Interrogation_Position=3902; Antisense; GTGCTGGTCTAGAAGGGAATCCCCT
>probe:Drosophila_2:1634693_at:486:515; Interrogation_Position=3916; Antisense; GGGAATCCCCTAGAGATTTCTATTT
>probe:Drosophila_2:1634693_at:599:729; Interrogation_Position=3939; Antisense; TTGGATACCCTCTTGTGTAACGTTT

Paste this into a BLAST search page for me
AATGAATCCAAGACCTTCCTACTGGTTCCTACTGGCCATGCAATCGGAGAGCAGCGCTTCAAAAGGCCGTGGATGGACAGGGTATCGATCGGCATTTGTTTCCAAGGGTTACGTCCGATCGGTGACAGGTAGCCACCTCCAATGAAGGGTAGGGTTCATGGCATACGGACCACTTGGACCACTTCTATCCGACGGATATGGAAAGTAAGATCACCTTCGCCATCTTCGCCATCTCCGCTTGGAAAAGTTGAACGTGCGGGCGAACATCCATGTAAGTGCTGGTCTAGAAGGGAATCCCCTGGGAATCCCCTAGAGATTTCTATTTTTGGATACCCTCTTGTGTAACGTTT

Full Affymetrix probeset data:

Annotations for 1634693_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime