FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634694_at:

>probe:Drosophila_2:1634694_at:248:595; Interrogation_Position=1007; Antisense; TGGGCGGCGACAACATGACCGTCAT
>probe:Drosophila_2:1634694_at:280:503; Interrogation_Position=1038; Antisense; GTGCCTGCTGCACAACAAGAGCTAC
>probe:Drosophila_2:1634694_at:352:129; Interrogation_Position=1111; Antisense; ACCGTAGGCGACATCCAGGATCAGT
>probe:Drosophila_2:1634694_at:416:499; Interrogation_Position=1134; Antisense; GTCGGTGAAGGTCGTAACTCCCTGT
>probe:Drosophila_2:1634694_at:533:623; Interrogation_Position=1180; Antisense; TCGACTTCTCGATTGGGCCTGGGCT
>probe:Drosophila_2:1634694_at:551:307; Interrogation_Position=1220; Antisense; GCGAAACTCCCGAGGCTAATCTTTA
>probe:Drosophila_2:1634694_at:473:345; Interrogation_Position=1278; Antisense; GCATTTGTTTGCTCTTACTCTTAAT
>probe:Drosophila_2:1634694_at:560:489; Interrogation_Position=1311; Antisense; GTACTTTGATTGTCGATCCAGACGC
>probe:Drosophila_2:1634694_at:577:447; Interrogation_Position=1325; Antisense; GATCCAGACGCTGTTGGCACTACAA
>probe:Drosophila_2:1634694_at:1:687; Interrogation_Position=1353; Antisense; TATCAGTCAACACATCACATTTCCC
>probe:Drosophila_2:1634694_at:4:589; Interrogation_Position=845; Antisense; TGGAGTTTGTCCTGCTGGCCTGCGA
>probe:Drosophila_2:1634694_at:255:421; Interrogation_Position=888; Antisense; GAGCAACTTCGAAGTCTGCCAGTTC
>probe:Drosophila_2:1634694_at:14:93; Interrogation_Position=908; Antisense; AGTTCGTGCACAAGCGCATACGCGA
>probe:Drosophila_2:1634694_at:325:607; Interrogation_Position=965; Antisense; TGATGAACAGCTGCTTGTCTCCGGA

Paste this into a BLAST search page for me
TGGGCGGCGACAACATGACCGTCATGTGCCTGCTGCACAACAAGAGCTACACCGTAGGCGACATCCAGGATCAGTGTCGGTGAAGGTCGTAACTCCCTGTTCGACTTCTCGATTGGGCCTGGGCTGCGAAACTCCCGAGGCTAATCTTTAGCATTTGTTTGCTCTTACTCTTAATGTACTTTGATTGTCGATCCAGACGCGATCCAGACGCTGTTGGCACTACAATATCAGTCAACACATCACATTTCCCTGGAGTTTGTCCTGCTGGCCTGCGAGAGCAACTTCGAAGTCTGCCAGTTCAGTTCGTGCACAAGCGCATACGCGATGATGAACAGCTGCTTGTCTCCGGA

Full Affymetrix probeset data:

Annotations for 1634694_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720