Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634695_at:

>probe:Drosophila_2:1634695_at:301:239; Interrogation_Position=2982; Antisense; AATCAGAAGCGCGTTCTCTTGCTTT
>probe:Drosophila_2:1634695_at:255:719; Interrogation_Position=3000; Antisense; TTGCTTTCCCTTACTGCTGGCGGTG
>probe:Drosophila_2:1634695_at:434:479; Interrogation_Position=3028; Antisense; GTTTGAACCTGATTGGTGCCAACCA
>probe:Drosophila_2:1634695_at:471:203; Interrogation_Position=3048; Antisense; AACCACCTGTTGCTTTTGGATCTGC
>probe:Drosophila_2:1634695_at:674:545; Interrogation_Position=3065; Antisense; GGATCTGCACTGGAATCCTCAGTTG
>probe:Drosophila_2:1634695_at:578:437; Interrogation_Position=3090; Antisense; GAGGCTCAGGCCCAGGACCGTATAT
>probe:Drosophila_2:1634695_at:257:555; Interrogation_Position=3104; Antisense; GGACCGTATATACCGCGTTGGCCAA
>probe:Drosophila_2:1634695_at:282:697; Interrogation_Position=3145; Antisense; TTTATAAGTTCATGTGCGTGGACAC
>probe:Drosophila_2:1634695_at:407:291; Interrogation_Position=3161; Antisense; CGTGGACACAGTTGAGCAGCGGATC
>probe:Drosophila_2:1634695_at:146:163; Interrogation_Position=3204; Antisense; AAATTGGATCTTGCCGATGGTGTCC
>probe:Drosophila_2:1634695_at:652:441; Interrogation_Position=3219; Antisense; GATGGTGTCCTTACAGGCGCCAAAG
>probe:Drosophila_2:1634695_at:442:709; Interrogation_Position=3229; Antisense; TTACAGGCGCCAAAGTTAGCTCTAA
>probe:Drosophila_2:1634695_at:72:513; Interrogation_Position=3290; Antisense; GTGAGCTTGCTTTTAACGTTTCGTA
>probe:Drosophila_2:1634695_at:416:477; Interrogation_Position=3307; Antisense; GTTTCGTATTTTATCAACTTCCATA

Paste this into a BLAST search page for me
AATCAGAAGCGCGTTCTCTTGCTTTTTGCTTTCCCTTACTGCTGGCGGTGGTTTGAACCTGATTGGTGCCAACCAAACCACCTGTTGCTTTTGGATCTGCGGATCTGCACTGGAATCCTCAGTTGGAGGCTCAGGCCCAGGACCGTATATGGACCGTATATACCGCGTTGGCCAATTTATAAGTTCATGTGCGTGGACACCGTGGACACAGTTGAGCAGCGGATCAAATTGGATCTTGCCGATGGTGTCCGATGGTGTCCTTACAGGCGCCAAAGTTACAGGCGCCAAAGTTAGCTCTAAGTGAGCTTGCTTTTAACGTTTCGTAGTTTCGTATTTTATCAACTTCCATA

Full Affymetrix probeset data:

Annotations for 1634695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime