Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634696_at:

>probe:Drosophila_2:1634696_at:599:303; Interrogation_Position=3264; Antisense; CCGAATCCGATTTAACTGCCCAAGT
>probe:Drosophila_2:1634696_at:315:365; Interrogation_Position=3320; Antisense; GAATATCAATCGCAACTGGGCCATG
>probe:Drosophila_2:1634696_at:683:171; Interrogation_Position=3354; Antisense; AAAGCTTTGGCTTCGATCCAGCAGA
>probe:Drosophila_2:1634696_at:668:95; Interrogation_Position=3402; Antisense; AGATTATCAGCCTTTACATCGCCGA
>probe:Drosophila_2:1634696_at:304:193; Interrogation_Position=3436; Antisense; AACTGCCAGCGAAACGGAATTCCGT
>probe:Drosophila_2:1634696_at:596:277; Interrogation_Position=3465; Antisense; CTTTGGAACTTCTGAGCTACGTGGA
>probe:Drosophila_2:1634696_at:486:199; Interrogation_Position=3534; Antisense; AACGCGATAACTGGACGGACTACGA
>probe:Drosophila_2:1634696_at:138:671; Interrogation_Position=3554; Antisense; TACGATCCCAACAATGCGGTGCATT
>probe:Drosophila_2:1634696_at:382:263; Interrogation_Position=3620; Antisense; CAGCTGATGGGCAACGATTCCGAGA
>probe:Drosophila_2:1634696_at:17:107; Interrogation_Position=3642; Antisense; AGAACGTTTTGCCACCCATGGAAGA
>probe:Drosophila_2:1634696_at:212:695; Interrogation_Position=3694; Antisense; TTTGCCGCAGCAGAAACCGTTTCAG
>probe:Drosophila_2:1634696_at:315:285; Interrogation_Position=3731; Antisense; CTGACCTATGAGTATGTGGCCGACA
>probe:Drosophila_2:1634696_at:523:585; Interrogation_Position=3777; Antisense; TGGAACTCTAATCAAGCACCTCACA
>probe:Drosophila_2:1634696_at:414:113; Interrogation_Position=3791; Antisense; AGCACCTCACATGTCTTTCTATTAA

Paste this into a BLAST search page for me
CCGAATCCGATTTAACTGCCCAAGTGAATATCAATCGCAACTGGGCCATGAAAGCTTTGGCTTCGATCCAGCAGAAGATTATCAGCCTTTACATCGCCGAAACTGCCAGCGAAACGGAATTCCGTCTTTGGAACTTCTGAGCTACGTGGAAACGCGATAACTGGACGGACTACGATACGATCCCAACAATGCGGTGCATTCAGCTGATGGGCAACGATTCCGAGAAGAACGTTTTGCCACCCATGGAAGATTTGCCGCAGCAGAAACCGTTTCAGCTGACCTATGAGTATGTGGCCGACATGGAACTCTAATCAAGCACCTCACAAGCACCTCACATGTCTTTCTATTAA

Full Affymetrix probeset data:

Annotations for 1634696_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime