Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634697_at:

>probe:Drosophila_2:1634697_at:218:721; Interrogation_Position=103; Antisense; TTGCGAGATCGGTGGGCATCAGTTC
>probe:Drosophila_2:1634697_at:13:519; Interrogation_Position=114; Antisense; GTGGGCATCAGTTCAAGACCGGAGA
>probe:Drosophila_2:1634697_at:136:649; Interrogation_Position=126; Antisense; TCAAGACCGGAGAGAAGTACACGCC
>probe:Drosophila_2:1634697_at:521:217; Interrogation_Position=140; Antisense; AAGTACACGCCGGAAGGTCGCTGCC
>probe:Drosophila_2:1634697_at:603:223; Interrogation_Position=153; Antisense; AAGGTCGCTGCCTGCAGTACACCTG
>probe:Drosophila_2:1634697_at:447:179; Interrogation_Position=188; Antisense; AAACAGGTGACTGCCTTGGGATGCC
>probe:Drosophila_2:1634697_at:430:607; Interrogation_Position=195; Antisense; TGACTGCCTTGGGATGCCCGGCCAT
>probe:Drosophila_2:1634697_at:646:629; Interrogation_Position=224; Antisense; TCCTTGAAGCCCTGCAAAATGGAAG
>probe:Drosophila_2:1634697_at:41:437; Interrogation_Position=248; Antisense; GAGGATCTGAGCAAACCCTATCCCG
>probe:Drosophila_2:1634697_at:650:571; Interrogation_Position=272; Antisense; GGCTGCTGTCCCAAGTTCAACTGCT
>probe:Drosophila_2:1634697_at:462:217; Interrogation_Position=284; Antisense; AAGTTCAACTGCTGACAACGCCTCC
>probe:Drosophila_2:1634697_at:331:633; Interrogation_Position=306; Antisense; TCCCTCGCAAGTCGAACTGCAAATG
>probe:Drosophila_2:1634697_at:383:611; Interrogation_Position=33; Antisense; TGAAATCGGTCACGTTCGTACTCTG
>probe:Drosophila_2:1634697_at:647:487; Interrogation_Position=50; Antisense; GTACTCTGCCTGCTCGTTCTGGGCG

Paste this into a BLAST search page for me
TTGCGAGATCGGTGGGCATCAGTTCGTGGGCATCAGTTCAAGACCGGAGATCAAGACCGGAGAGAAGTACACGCCAAGTACACGCCGGAAGGTCGCTGCCAAGGTCGCTGCCTGCAGTACACCTGAAACAGGTGACTGCCTTGGGATGCCTGACTGCCTTGGGATGCCCGGCCATTCCTTGAAGCCCTGCAAAATGGAAGGAGGATCTGAGCAAACCCTATCCCGGGCTGCTGTCCCAAGTTCAACTGCTAAGTTCAACTGCTGACAACGCCTCCTCCCTCGCAAGTCGAACTGCAAATGTGAAATCGGTCACGTTCGTACTCTGGTACTCTGCCTGCTCGTTCTGGGCG

Full Affymetrix probeset data:

Annotations for 1634697_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime