FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634700_at:

>probe:Drosophila_2:1634700_at:535:51; Interrogation_Position=1378; Antisense; ATGCTGATACTCTGCCTGGTCTGGA
>probe:Drosophila_2:1634700_at:710:487; Interrogation_Position=1406; Antisense; GTACGCCGTGCGCAAGTTCGCTAAT
>probe:Drosophila_2:1634700_at:507:233; Interrogation_Position=1428; Antisense; AATGCGCTGGAAGTTTTCCCCAAGG
>probe:Drosophila_2:1634700_at:504:423; Interrogation_Position=1461; Antisense; GAGAACTCCGGCATCAATGGCACGG
>probe:Drosophila_2:1634700_at:102:495; Interrogation_Position=1491; Antisense; GTCAACCAGTTGTATTTGGCCCACA
>probe:Drosophila_2:1634700_at:182:397; Interrogation_Position=1532; Antisense; GACAATCGGCTTCGACATTGAGGCC
>probe:Drosophila_2:1634700_at:289:207; Interrogation_Position=1590; Antisense; AAGCTCTTCGATCTGTACCAGTCCA
>probe:Drosophila_2:1634700_at:4:219; Interrogation_Position=1629; Antisense; AAGTACGCTGTTGGCGCGGCCGCAA
>probe:Drosophila_2:1634700_at:366:331; Interrogation_Position=1644; Antisense; GCGGCCGCAACCATCTTGAAGGTGG
>probe:Drosophila_2:1634700_at:182:223; Interrogation_Position=1662; Antisense; AAGGTGGACCAGATCATCATGGCCA
>probe:Drosophila_2:1634700_at:371:93; Interrogation_Position=1737; Antisense; AGTTAAGCGGCTCCTCTGTGATTCG
>probe:Drosophila_2:1634700_at:295:463; Interrogation_Position=1756; Antisense; GATTCGTACTCCCTACTATAACTAG
>probe:Drosophila_2:1634700_at:624:163; Interrogation_Position=1841; Antisense; AAATTTCATTAACCACTCTCACACT
>probe:Drosophila_2:1634700_at:176:157; Interrogation_Position=1877; Antisense; ACAGCCATGCACACAGTTTCTTGTA

Paste this into a BLAST search page for me
ATGCTGATACTCTGCCTGGTCTGGAGTACGCCGTGCGCAAGTTCGCTAATAATGCGCTGGAAGTTTTCCCCAAGGGAGAACTCCGGCATCAATGGCACGGGTCAACCAGTTGTATTTGGCCCACAGACAATCGGCTTCGACATTGAGGCCAAGCTCTTCGATCTGTACCAGTCCAAAGTACGCTGTTGGCGCGGCCGCAAGCGGCCGCAACCATCTTGAAGGTGGAAGGTGGACCAGATCATCATGGCCAAGTTAAGCGGCTCCTCTGTGATTCGGATTCGTACTCCCTACTATAACTAGAAATTTCATTAACCACTCTCACACTACAGCCATGCACACAGTTTCTTGTA

Full Affymetrix probeset data:

Annotations for 1634700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720