FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634701_at:

>probe:Drosophila_2:1634701_at:513:409; Interrogation_Position=126; Antisense; GACGACTGTATGATGGAATTCCCAT
>probe:Drosophila_2:1634701_at:206:283; Interrogation_Position=15; Antisense; CTCCGATATCGTCAGTGCTGCGAAA
>probe:Drosophila_2:1634701_at:26:517; Interrogation_Position=183; Antisense; GTGGTAAAGGTCGAACTGCCGCCGC
>probe:Drosophila_2:1634701_at:538:141; Interrogation_Position=215; Antisense; ACTGACCTTTGAACTCATCCGCAAT
>probe:Drosophila_2:1634701_at:709:335; Interrogation_Position=246; Antisense; GCTGCCGACCAGGAGTGCGATGATA
>probe:Drosophila_2:1634701_at:213:327; Interrogation_Position=262; Antisense; GCGATGATAGCTTCGAAGGCTTCGT
>probe:Drosophila_2:1634701_at:309:71; Interrogation_Position=278; Antisense; AGGCTTCGTCGATGGTTATGATGAT
>probe:Drosophila_2:1634701_at:620:703; Interrogation_Position=293; Antisense; TTATGATGATCCCAGGCTGCCGGAA
>probe:Drosophila_2:1634701_at:30:573; Interrogation_Position=307; Antisense; GGCTGCCGGAAACCATCATCTGATT
>probe:Drosophila_2:1634701_at:320:181; Interrogation_Position=335; Antisense; AAAAAGCTTGCCACTCACTGGCATT
>probe:Drosophila_2:1634701_at:602:355; Interrogation_Position=362; Antisense; GCACTCCGCTTCATTTGGTTTAATT
>probe:Drosophila_2:1634701_at:10:501; Interrogation_Position=46; Antisense; GTCGGGCGAGCACCGCATAATCAGA
>probe:Drosophila_2:1634701_at:724:59; Interrogation_Position=78; Antisense; ATGTTTCTGGGCTTCTTGGTGGATC
>probe:Drosophila_2:1634701_at:577:727; Interrogation_Position=93; Antisense; TTGGTGGATCTGCTGTACTGCCGAC

Paste this into a BLAST search page for me
GACGACTGTATGATGGAATTCCCATCTCCGATATCGTCAGTGCTGCGAAAGTGGTAAAGGTCGAACTGCCGCCGCACTGACCTTTGAACTCATCCGCAATGCTGCCGACCAGGAGTGCGATGATAGCGATGATAGCTTCGAAGGCTTCGTAGGCTTCGTCGATGGTTATGATGATTTATGATGATCCCAGGCTGCCGGAAGGCTGCCGGAAACCATCATCTGATTAAAAAGCTTGCCACTCACTGGCATTGCACTCCGCTTCATTTGGTTTAATTGTCGGGCGAGCACCGCATAATCAGAATGTTTCTGGGCTTCTTGGTGGATCTTGGTGGATCTGCTGTACTGCCGAC

Full Affymetrix probeset data:

Annotations for 1634701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720