Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634702_at:

>probe:Drosophila_2:1634702_at:354:33; Interrogation_Position=1712; Antisense; ATCAAGGCGCGCATTATGGCCAACT
>probe:Drosophila_2:1634702_at:502:311; Interrogation_Position=1730; Antisense; GCCAACTTGCTGGTGGAGCCCAAAA
>probe:Drosophila_2:1634702_at:584:189; Interrogation_Position=1783; Antisense; AACATTCTTTCCGTTGATCTGGGCG
>probe:Drosophila_2:1634702_at:484:543; Interrogation_Position=1807; Antisense; GGATTACAATGTCCGCATCACGGAT
>probe:Drosophila_2:1634702_at:178:271; Interrogation_Position=1822; Antisense; CATCACGGATGATCTTCTGGTCTAC
>probe:Drosophila_2:1634702_at:647:715; Interrogation_Position=1836; Antisense; TTCTGGTCTACGTGAAGCTAATGCC
>probe:Drosophila_2:1634702_at:74:119; Interrogation_Position=1851; Antisense; AGCTAATGCCGATCCTTGAGTTTGT
>probe:Drosophila_2:1634702_at:426:729; Interrogation_Position=1872; Antisense; TTGTGGGCAAGATCTGTGGCATCCT
>probe:Drosophila_2:1634702_at:283:497; Interrogation_Position=1904; Antisense; GTCTTGGGTTTGCTGATGGTATTCT
>probe:Drosophila_2:1634702_at:559:539; Interrogation_Position=1921; Antisense; GGTATTCTGGTATCCCCATCAAATG
>probe:Drosophila_2:1634702_at:496:415; Interrogation_Position=1957; Antisense; GAGCCTGATGCACAAGATCGAGATT
>probe:Drosophila_2:1634702_at:427:293; Interrogation_Position=1975; Antisense; CGAGATTAGTTCCATCGAGACGAAT
>probe:Drosophila_2:1634702_at:424:73; Interrogation_Position=2034; Antisense; AGGACTCGCCACTGCTGAAGGGATT
>probe:Drosophila_2:1634702_at:700:221; Interrogation_Position=2140; Antisense; AAGGTTTTTCTTGCCTAGTCTACAG

Paste this into a BLAST search page for me
ATCAAGGCGCGCATTATGGCCAACTGCCAACTTGCTGGTGGAGCCCAAAAAACATTCTTTCCGTTGATCTGGGCGGGATTACAATGTCCGCATCACGGATCATCACGGATGATCTTCTGGTCTACTTCTGGTCTACGTGAAGCTAATGCCAGCTAATGCCGATCCTTGAGTTTGTTTGTGGGCAAGATCTGTGGCATCCTGTCTTGGGTTTGCTGATGGTATTCTGGTATTCTGGTATCCCCATCAAATGGAGCCTGATGCACAAGATCGAGATTCGAGATTAGTTCCATCGAGACGAATAGGACTCGCCACTGCTGAAGGGATTAAGGTTTTTCTTGCCTAGTCTACAG

Full Affymetrix probeset data:

Annotations for 1634702_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime