Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634704_at:

>probe:Drosophila_2:1634704_at:73:559; Interrogation_Position=3458; Antisense; GGACATTGTCCTGATGCGCAACGAT
>probe:Drosophila_2:1634704_at:331:39; Interrogation_Position=3481; Antisense; ATCTGCTGGATGTGGTGGCTTGCCT
>probe:Drosophila_2:1634704_at:373:533; Interrogation_Position=3524; Antisense; GGTGCGTCGCATTCGGTACAACTTC
>probe:Drosophila_2:1634704_at:156:665; Interrogation_Position=3540; Antisense; TACAACTTCTTCTTTGCCAGCATGT
>probe:Drosophila_2:1634704_at:5:601; Interrogation_Position=3562; Antisense; TGTACAATCTGCTGGGCATACCGCT
>probe:Drosophila_2:1634704_at:389:43; Interrogation_Position=3680; Antisense; ATCGCTGCTGCTCAAGATGTATCGC
>probe:Drosophila_2:1634704_at:503:211; Interrogation_Position=3717; Antisense; AAGACGTTGCGCACGGCAGAGTACG
>probe:Drosophila_2:1634704_at:310:579; Interrogation_Position=3809; Antisense; TGGCCTTGACGATTTGCCCGAAAAG
>probe:Drosophila_2:1634704_at:455:537; Interrogation_Position=3834; Antisense; GGTAGGATGCCATTCAAGCGGTCCA
>probe:Drosophila_2:1634704_at:522:205; Interrogation_Position=3849; Antisense; AAGCGGTCCAGCACATCACTGATTT
>probe:Drosophila_2:1634704_at:577:345; Interrogation_Position=3877; Antisense; GCATTTTCATGCACGACTACGGGAA
>probe:Drosophila_2:1634704_at:257:669; Interrogation_Position=3894; Antisense; TACGGGAACATCACTTCGCCGGATG
>probe:Drosophila_2:1634704_at:576:75; Interrogation_Position=3949; Antisense; AGGAGCAGTATGATGGCCGCACCAA
>probe:Drosophila_2:1634704_at:23:609; Interrogation_Position=3979; Antisense; TGAGGAGTCGCTTCCATGCCAATGA

Paste this into a BLAST search page for me
GGACATTGTCCTGATGCGCAACGATATCTGCTGGATGTGGTGGCTTGCCTGGTGCGTCGCATTCGGTACAACTTCTACAACTTCTTCTTTGCCAGCATGTTGTACAATCTGCTGGGCATACCGCTATCGCTGCTGCTCAAGATGTATCGCAAGACGTTGCGCACGGCAGAGTACGTGGCCTTGACGATTTGCCCGAAAAGGGTAGGATGCCATTCAAGCGGTCCAAAGCGGTCCAGCACATCACTGATTTGCATTTTCATGCACGACTACGGGAATACGGGAACATCACTTCGCCGGATGAGGAGCAGTATGATGGCCGCACCAATGAGGAGTCGCTTCCATGCCAATGA

Full Affymetrix probeset data:

Annotations for 1634704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime