FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634705_at:

>probe:Drosophila_2:1634705_at:292:553; Interrogation_Position=1295; Antisense; GGAGCACGATGTAGAACCACCAGCC
>probe:Drosophila_2:1634705_at:304:297; Interrogation_Position=1319; Antisense; CCGCTACGTAGATCACTCGGATGAT
>probe:Drosophila_2:1634705_at:444:351; Interrogation_Position=1365; Antisense; GCAGAGCAGCGAAAGCGCCGCCAAA
>probe:Drosophila_2:1634705_at:311:223; Interrogation_Position=1388; Antisense; AAGGGATCGCACAAACTCCACAGAT
>probe:Drosophila_2:1634705_at:422:139; Interrogation_Position=1422; Antisense; ACGGTAACCTCGGTGGCCACGACAG
>probe:Drosophila_2:1634705_at:214:127; Interrogation_Position=1445; Antisense; AGCCACTAAGGCTTCTTCAGTTGCT
>probe:Drosophila_2:1634705_at:657:517; Interrogation_Position=1497; Antisense; GGGCAACGAGAGAGTTTCCGCCAGA
>probe:Drosophila_2:1634705_at:656:29; Interrogation_Position=1574; Antisense; ATACAACTTCCATCCAAGCTACAAT
>probe:Drosophila_2:1634705_at:641:673; Interrogation_Position=1623; Antisense; TACCAGAACTATCACCAGGCAGCGG
>probe:Drosophila_2:1634705_at:327:71; Interrogation_Position=1639; Antisense; AGGCAGCGGCTAACTTTAACATGGC
>probe:Drosophila_2:1634705_at:53:711; Interrogation_Position=1654; Antisense; TTAACATGGCTCAGCAGCATCCTGG
>probe:Drosophila_2:1634705_at:549:719; Interrogation_Position=1686; Antisense; TTCCCAGTGCCTAACTATGGCTACG
>probe:Drosophila_2:1634705_at:157:387; Interrogation_Position=1784; Antisense; GAACAACCAGTCACATCAGGGTCAG
>probe:Drosophila_2:1634705_at:16:321; Interrogation_Position=1808; Antisense; GCCGCCACCCAGCTAGAGATAGGTA

Paste this into a BLAST search page for me
GGAGCACGATGTAGAACCACCAGCCCCGCTACGTAGATCACTCGGATGATGCAGAGCAGCGAAAGCGCCGCCAAAAAGGGATCGCACAAACTCCACAGATACGGTAACCTCGGTGGCCACGACAGAGCCACTAAGGCTTCTTCAGTTGCTGGGCAACGAGAGAGTTTCCGCCAGAATACAACTTCCATCCAAGCTACAATTACCAGAACTATCACCAGGCAGCGGAGGCAGCGGCTAACTTTAACATGGCTTAACATGGCTCAGCAGCATCCTGGTTCCCAGTGCCTAACTATGGCTACGGAACAACCAGTCACATCAGGGTCAGGCCGCCACCCAGCTAGAGATAGGTA

Full Affymetrix probeset data:

Annotations for 1634705_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720