FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634709_at:

>probe:Drosophila_2:1634709_at:637:431; Interrogation_Position=2016; Antisense; GATCGTAGTTTAGTCGCTCGTAAGA
>probe:Drosophila_2:1634709_at:604:567; Interrogation_Position=2055; Antisense; GGCAGCTGAGCGTCAAACGTACATT
>probe:Drosophila_2:1634709_at:188:293; Interrogation_Position=2072; Antisense; CGTACATTGATTTATCCGTTAGGAA
>probe:Drosophila_2:1634709_at:689:673; Interrogation_Position=2098; Antisense; TTATTTTAGACCCTGAACACTTTGG
>probe:Drosophila_2:1634709_at:173:693; Interrogation_Position=2154; Antisense; TTTTTAAAGCCCCATCCGATTGCTA
>probe:Drosophila_2:1634709_at:726:319; Interrogation_Position=2162; Antisense; GCCCCATCCGATTGCTATTTTAAGA
>probe:Drosophila_2:1634709_at:477:171; Interrogation_Position=2213; Antisense; AAAGTACAAGTATTCATCCCACCCA
>probe:Drosophila_2:1634709_at:217:171; Interrogation_Position=2249; Antisense; AAACATTTCAGCGAGTAACCATTAA
>probe:Drosophila_2:1634709_at:230:391; Interrogation_Position=2289; Antisense; GAAACTCCATGCGATTGCCATCAAT
>probe:Drosophila_2:1634709_at:54:645; Interrogation_Position=2352; Antisense; TCATACTACGGTCAGCAGAGCTTTT
>probe:Drosophila_2:1634709_at:419:699; Interrogation_Position=2431; Antisense; TTATACGTAATCTAAGGCCATATGA
>probe:Drosophila_2:1634709_at:680:75; Interrogation_Position=2456; Antisense; AGGAGCCCAAGGAGCTTGCATTTCT
>probe:Drosophila_2:1634709_at:86:553; Interrogation_Position=2466; Antisense; GGAGCTTGCATTTCTATACACCTAT
>probe:Drosophila_2:1634709_at:69:515; Interrogation_Position=2569; Antisense; GTGTCTACAATTTTTATATCTTACG

Paste this into a BLAST search page for me
GATCGTAGTTTAGTCGCTCGTAAGAGGCAGCTGAGCGTCAAACGTACATTCGTACATTGATTTATCCGTTAGGAATTATTTTAGACCCTGAACACTTTGGTTTTTAAAGCCCCATCCGATTGCTAGCCCCATCCGATTGCTATTTTAAGAAAAGTACAAGTATTCATCCCACCCAAAACATTTCAGCGAGTAACCATTAAGAAACTCCATGCGATTGCCATCAATTCATACTACGGTCAGCAGAGCTTTTTTATACGTAATCTAAGGCCATATGAAGGAGCCCAAGGAGCTTGCATTTCTGGAGCTTGCATTTCTATACACCTATGTGTCTACAATTTTTATATCTTACG

Full Affymetrix probeset data:

Annotations for 1634709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720