FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634713_at:

>probe:Drosophila_2:1634713_at:346:635; Interrogation_Position=119; Antisense; TCGCCGCCGGAGGAATCATGGGATA
>probe:Drosophila_2:1634713_at:107:381; Interrogation_Position=297; Antisense; GAACCGATCCGGAAAACTGATGCCC
>probe:Drosophila_2:1634713_at:499:229; Interrogation_Position=327; Antisense; AATGGTGTGCATGCTATCCGTGGCC
>probe:Drosophila_2:1634713_at:443:47; Interrogation_Position=342; Antisense; ATCCGTGGCCGCCTTGGTCAAGAAC
>probe:Drosophila_2:1634713_at:263:581; Interrogation_Position=368; Antisense; TGGCCACCTATAATCGCTACCTAAT
>probe:Drosophila_2:1634713_at:402:355; Interrogation_Position=401; Antisense; GCACAAAGGCCCCTTAGGCTAATTT
>probe:Drosophila_2:1634713_at:222:653; Interrogation_Position=420; Antisense; TAATTTCCGGCCACATGCTGGACTT
>probe:Drosophila_2:1634713_at:408:585; Interrogation_Position=438; Antisense; TGGACTTGCCAGGAGATTGCCCTAC
>probe:Drosophila_2:1634713_at:628:301; Interrogation_Position=458; Antisense; CCTACCTTCATTCTTCATTCGTATT
>probe:Drosophila_2:1634713_at:100:679; Interrogation_Position=486; Antisense; TAGGTTTTCTACTTTTCGGTGATTG
>probe:Drosophila_2:1634713_at:52:193; Interrogation_Position=512; Antisense; AACTTTGGTAATGCGCTGTGTCACT
>probe:Drosophila_2:1634713_at:334:323; Interrogation_Position=524; Antisense; GCGCTGTGTCACTTTCTAAGATAGT
>probe:Drosophila_2:1634713_at:407:461; Interrogation_Position=549; Antisense; GATTAGGAACTGTACTTGCTGCAAA
>probe:Drosophila_2:1634713_at:514:639; Interrogation_Position=95; Antisense; TCGGATATGTGTACGCAGCCACGGT

Paste this into a BLAST search page for me
TCGCCGCCGGAGGAATCATGGGATAGAACCGATCCGGAAAACTGATGCCCAATGGTGTGCATGCTATCCGTGGCCATCCGTGGCCGCCTTGGTCAAGAACTGGCCACCTATAATCGCTACCTAATGCACAAAGGCCCCTTAGGCTAATTTTAATTTCCGGCCACATGCTGGACTTTGGACTTGCCAGGAGATTGCCCTACCCTACCTTCATTCTTCATTCGTATTTAGGTTTTCTACTTTTCGGTGATTGAACTTTGGTAATGCGCTGTGTCACTGCGCTGTGTCACTTTCTAAGATAGTGATTAGGAACTGTACTTGCTGCAAATCGGATATGTGTACGCAGCCACGGT

Full Affymetrix probeset data:

Annotations for 1634713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720