Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634714_at:

>probe:Drosophila_2:1634714_at:613:543; Interrogation_Position=1854; Antisense; GGATAACAATCAACTGACCCCGCAG
>probe:Drosophila_2:1634714_at:332:473; Interrogation_Position=1932; Antisense; GTTCAGTGTGGAGACCACCCTGGAT
>probe:Drosophila_2:1634714_at:15:31; Interrogation_Position=1979; Antisense; ATAAGTACCGACCACGAAAGCCGCG
>probe:Drosophila_2:1634714_at:27:617; Interrogation_Position=2018; Antisense; TGCACACCGGCTTCGAGTGGAACAA
>probe:Drosophila_2:1634714_at:177:105; Interrogation_Position=2051; Antisense; AGACGCACTACGACATGGACAATCC
>probe:Drosophila_2:1634714_at:55:473; Interrogation_Position=2103; Antisense; GTTCAACATATTCTATCCGGACCTT
>probe:Drosophila_2:1634714_at:141:67; Interrogation_Position=2128; Antisense; ATGGACAAATCGCAGACGCCGCAGT
>probe:Drosophila_2:1634714_at:211:75; Interrogation_Position=2222; Antisense; AGGACATCGCCTTCAAGATCGTCAA
>probe:Drosophila_2:1634714_at:422:595; Interrogation_Position=2312; Antisense; TGTGGTTCCACTTCAAGCGCTATCG
>probe:Drosophila_2:1634714_at:14:207; Interrogation_Position=2326; Antisense; AAGCGCTATCGCTACAGGCGGTGAA
>probe:Drosophila_2:1634714_at:476:613; Interrogation_Position=2347; Antisense; TGAAGGATTGTCACCGTCTGGCCTA
>probe:Drosophila_2:1634714_at:425:499; Interrogation_Position=2362; Antisense; GTCTGGCCTAGATTACCCAAACCAT
>probe:Drosophila_2:1634714_at:375:175; Interrogation_Position=2380; Antisense; AAACCATCCTTTTGTGCAGTCCTAT
>probe:Drosophila_2:1634714_at:392:509; Interrogation_Position=2393; Antisense; GTGCAGTCCTATGTTATTTTCCAAT

Paste this into a BLAST search page for me
GGATAACAATCAACTGACCCCGCAGGTTCAGTGTGGAGACCACCCTGGATATAAGTACCGACCACGAAAGCCGCGTGCACACCGGCTTCGAGTGGAACAAAGACGCACTACGACATGGACAATCCGTTCAACATATTCTATCCGGACCTTATGGACAAATCGCAGACGCCGCAGTAGGACATCGCCTTCAAGATCGTCAATGTGGTTCCACTTCAAGCGCTATCGAAGCGCTATCGCTACAGGCGGTGAATGAAGGATTGTCACCGTCTGGCCTAGTCTGGCCTAGATTACCCAAACCATAAACCATCCTTTTGTGCAGTCCTATGTGCAGTCCTATGTTATTTTCCAAT

Full Affymetrix probeset data:

Annotations for 1634714_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime