Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634716_s_at:

>probe:Drosophila_2:1634716_s_at:304:103; Interrogation_Position=110; Antisense; AGAGCCTGGCGAGTTCGTCGTCCTT
>probe:Drosophila_2:1634716_s_at:50:319; Interrogation_Position=147; Antisense; GCGCGACCGGATGCCGTTCCTGAAA
>probe:Drosophila_2:1634716_s_at:459:177; Interrogation_Position=169; Antisense; AAACGGCGACAAACTATCGACCACT
>probe:Drosophila_2:1634716_s_at:134:313; Interrogation_Position=197; Antisense; GCCAGAGCCAGCCACTCATGGAGGA
>probe:Drosophila_2:1634716_s_at:156:289; Interrogation_Position=225; Antisense; CGGAGAGACCGTTGGCCAGGCCAAA
>probe:Drosophila_2:1634716_s_at:525:165; Interrogation_Position=247; Antisense; AAATCCGCGCCAGGTGCCGTTGACA
>probe:Drosophila_2:1634716_s_at:156:507; Interrogation_Position=260; Antisense; GTGCCGTTGACAGGCCGACATTGAT
>probe:Drosophila_2:1634716_s_at:165:403; Interrogation_Position=276; Antisense; GACATTGATGACGACCATTGCGGAA
>probe:Drosophila_2:1634716_s_at:188:229; Interrogation_Position=415; Antisense; AATGGCATGGGCACTGTCATCGTTC
>probe:Drosophila_2:1634716_s_at:461:355; Interrogation_Position=425; Antisense; GCACTGTCATCGTTCGCATGGAGAG
>probe:Drosophila_2:1634716_s_at:599:115; Interrogation_Position=461; Antisense; AGCATATGGCCGATGAGGCGCTTTA
>probe:Drosophila_2:1634716_s_at:363:175; Interrogation_Position=68; Antisense; AAAGCCACCAGTTGTCCACGGATCA
>probe:Drosophila_2:1634716_s_at:325:727; Interrogation_Position=79; Antisense; TTGTCCACGGATCAGCAGAGAGCTC
>probe:Drosophila_2:1634716_s_at:478:35; Interrogation_Position=89; Antisense; ATCAGCAGAGAGCTCGCAGCCAGAG

Paste this into a BLAST search page for me
AGAGCCTGGCGAGTTCGTCGTCCTTGCGCGACCGGATGCCGTTCCTGAAAAAACGGCGACAAACTATCGACCACTGCCAGAGCCAGCCACTCATGGAGGACGGAGAGACCGTTGGCCAGGCCAAAAAATCCGCGCCAGGTGCCGTTGACAGTGCCGTTGACAGGCCGACATTGATGACATTGATGACGACCATTGCGGAAAATGGCATGGGCACTGTCATCGTTCGCACTGTCATCGTTCGCATGGAGAGAGCATATGGCCGATGAGGCGCTTTAAAAGCCACCAGTTGTCCACGGATCATTGTCCACGGATCAGCAGAGAGCTCATCAGCAGAGAGCTCGCAGCCAGAG

Full Affymetrix probeset data:

Annotations for 1634716_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime