FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634717_at:

>probe:Drosophila_2:1634717_at:40:45; Interrogation_Position=442; Antisense; ATCGCAGTCTACATTTGCCTGTTTG
>probe:Drosophila_2:1634717_at:614:91; Interrogation_Position=523; Antisense; AGTTATTCATTTGTCTGTTCTCCTG
>probe:Drosophila_2:1634717_at:611:499; Interrogation_Position=535; Antisense; GTCTGTTCTCCTGTTTGAATTGTGA
>probe:Drosophila_2:1634717_at:524:339; Interrogation_Position=563; Antisense; GCTAAGCTTGGTTATATCACTATCA
>probe:Drosophila_2:1634717_at:60:29; Interrogation_Position=578; Antisense; ATCACTATCAACTTACGTGCAGTCC
>probe:Drosophila_2:1634717_at:698:509; Interrogation_Position=594; Antisense; GTGCAGTCCAATACTTGTCATACAT
>probe:Drosophila_2:1634717_at:134:413; Interrogation_Position=675; Antisense; GACCGCCTCCTTTATTGTTAACAAT
>probe:Drosophila_2:1634717_at:364:183; Interrogation_Position=703; Antisense; AAAAGCAAGGCCGAAGCCGCGCAAT
>probe:Drosophila_2:1634717_at:226:363; Interrogation_Position=723; Antisense; GCAATCTCCAGCAACACATGCAGAT
>probe:Drosophila_2:1634717_at:525:407; Interrogation_Position=763; Antisense; GACGTGTGTATTTGTGATGCTATTC
>probe:Drosophila_2:1634717_at:207:691; Interrogation_Position=793; Antisense; TATTGGAGCGCTTCCTTTTGATGGC
>probe:Drosophila_2:1634717_at:247:441; Interrogation_Position=812; Antisense; GATGGCGTTCTGGTTGACTCTTCAA
>probe:Drosophila_2:1634717_at:61:167; Interrogation_Position=899; Antisense; AAATCCTACGATTATTCACTGGCCC
>probe:Drosophila_2:1634717_at:80:643; Interrogation_Position=914; Antisense; TCACTGGCCCTATTTATTTTGGTGT

Paste this into a BLAST search page for me
ATCGCAGTCTACATTTGCCTGTTTGAGTTATTCATTTGTCTGTTCTCCTGGTCTGTTCTCCTGTTTGAATTGTGAGCTAAGCTTGGTTATATCACTATCAATCACTATCAACTTACGTGCAGTCCGTGCAGTCCAATACTTGTCATACATGACCGCCTCCTTTATTGTTAACAATAAAAGCAAGGCCGAAGCCGCGCAATGCAATCTCCAGCAACACATGCAGATGACGTGTGTATTTGTGATGCTATTCTATTGGAGCGCTTCCTTTTGATGGCGATGGCGTTCTGGTTGACTCTTCAAAAATCCTACGATTATTCACTGGCCCTCACTGGCCCTATTTATTTTGGTGT

Full Affymetrix probeset data:

Annotations for 1634717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720