FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634718_at:

>probe:Drosophila_2:1634718_at:90:279; Interrogation_Position=385; Antisense; CTATCGGAAGTACTGCGTCGGCACA
>probe:Drosophila_2:1634718_at:623:415; Interrogation_Position=451; Antisense; GAGCGCAGGCGGATCTTTACGAAAT
>probe:Drosophila_2:1634718_at:652:245; Interrogation_Position=473; Antisense; AATTGGGTTGCTACCAGGTCCACAA
>probe:Drosophila_2:1634718_at:653:505; Interrogation_Position=490; Antisense; GTCCACAATTGCTCCTATGCCAAGA
>probe:Drosophila_2:1634718_at:72:305; Interrogation_Position=537; Antisense; CCTGGAGTGCGGTAAGTGCCTTCAA
>probe:Drosophila_2:1634718_at:393:549; Interrogation_Position=660; Antisense; GGAGGTTCATCAGAGGCGCCATAAG
>probe:Drosophila_2:1634718_at:554:111; Interrogation_Position=683; Antisense; AGCAGCGACGCCACATAGTTAACAG
>probe:Drosophila_2:1634718_at:704:435; Interrogation_Position=715; Antisense; GAGGAACGTCCGCATCTTTGCAACG
>probe:Drosophila_2:1634718_at:96:693; Interrogation_Position=731; Antisense; TTTGCAACGTCTATCAGCGCAGTTT
>probe:Drosophila_2:1634718_at:89:123; Interrogation_Position=746; Antisense; AGCGCAGTTTCTCCAGGGTCTACAT
>probe:Drosophila_2:1634718_at:582:81; Interrogation_Position=760; Antisense; AGGGTCTACATGCTCGAGCTGCATC
>probe:Drosophila_2:1634718_at:142:613; Interrogation_Position=828; Antisense; TGACAAACGTTTCGCCCAACTGGGA
>probe:Drosophila_2:1634718_at:655:431; Interrogation_Position=851; Antisense; GAGTCCTCAAGATTCACGAGCGGAT
>probe:Drosophila_2:1634718_at:379:527; Interrogation_Position=933; Antisense; GGGACAGCTCCGAAAACACGCGTTG

Paste this into a BLAST search page for me
CTATCGGAAGTACTGCGTCGGCACAGAGCGCAGGCGGATCTTTACGAAATAATTGGGTTGCTACCAGGTCCACAAGTCCACAATTGCTCCTATGCCAAGACCTGGAGTGCGGTAAGTGCCTTCAAGGAGGTTCATCAGAGGCGCCATAAGAGCAGCGACGCCACATAGTTAACAGGAGGAACGTCCGCATCTTTGCAACGTTTGCAACGTCTATCAGCGCAGTTTAGCGCAGTTTCTCCAGGGTCTACATAGGGTCTACATGCTCGAGCTGCATCTGACAAACGTTTCGCCCAACTGGGAGAGTCCTCAAGATTCACGAGCGGATGGGACAGCTCCGAAAACACGCGTTG

Full Affymetrix probeset data:

Annotations for 1634718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720