FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634719_at:

>probe:Drosophila_2:1634719_at:108:341; Interrogation_Position=154; Antisense; GCATTCTAATCCAGCGTTTCGAGGT
>probe:Drosophila_2:1634719_at:160:397; Interrogation_Position=289; Antisense; GACACTTGTCCGTTGGCGTCAAGGA
>probe:Drosophila_2:1634719_at:458:507; Interrogation_Position=324; Antisense; GTGCTGTTGCCCAAATACGGTGGAA
>probe:Drosophila_2:1634719_at:172:91; Interrogation_Position=376; Antisense; AGTATGTTCTGTTCCGCGAGAGCGA
>probe:Drosophila_2:1634719_at:141:327; Interrogation_Position=391; Antisense; GCGAGAGCGATATCCTTGCTAAACT
>probe:Drosophila_2:1634719_at:426:459; Interrogation_Position=422; Antisense; GATTTGCAACACTTTCCGAAACATC
>probe:Drosophila_2:1634719_at:338:233; Interrogation_Position=473; Antisense; AATGCTCCAAGCAATACTCATCCTC
>probe:Drosophila_2:1634719_at:384:37; Interrogation_Position=500; Antisense; ATCTCGTCACTTATCTTCGGTGGAG
>probe:Drosophila_2:1634719_at:645:423; Interrogation_Position=522; Antisense; GAGACTGTCATTTTGCTTCCGAATT
>probe:Drosophila_2:1634719_at:186:719; Interrogation_Position=534; Antisense; TTGCTTCCGAATTGCGTTCGAAACT
>probe:Drosophila_2:1634719_at:332:539; Interrogation_Position=586; Antisense; GGTAAATGGCCAATCTACACACTCC
>probe:Drosophila_2:1634719_at:83:405; Interrogation_Position=624; Antisense; GACTATGAAACATGTCGCGCCTGCT
>probe:Drosophila_2:1634719_at:68:621; Interrogation_Position=645; Antisense; TGCTCTTATAGCTACCACTCACACT
>probe:Drosophila_2:1634719_at:475:99; Interrogation_Position=707; Antisense; AGATGTGCCTTTTGTGTCTTATCAA

Paste this into a BLAST search page for me
GCATTCTAATCCAGCGTTTCGAGGTGACACTTGTCCGTTGGCGTCAAGGAGTGCTGTTGCCCAAATACGGTGGAAAGTATGTTCTGTTCCGCGAGAGCGAGCGAGAGCGATATCCTTGCTAAACTGATTTGCAACACTTTCCGAAACATCAATGCTCCAAGCAATACTCATCCTCATCTCGTCACTTATCTTCGGTGGAGGAGACTGTCATTTTGCTTCCGAATTTTGCTTCCGAATTGCGTTCGAAACTGGTAAATGGCCAATCTACACACTCCGACTATGAAACATGTCGCGCCTGCTTGCTCTTATAGCTACCACTCACACTAGATGTGCCTTTTGTGTCTTATCAA

Full Affymetrix probeset data:

Annotations for 1634719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720