FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634720_at:

>probe:Drosophila_2:1634720_at:428:255; Interrogation_Position=153; Antisense; CAACAACCATGTCTCTGCAGTCGGA
>probe:Drosophila_2:1634720_at:37:639; Interrogation_Position=173; Antisense; TCGGACGCCGTTTTCCAAAAGATCA
>probe:Drosophila_2:1634720_at:136:537; Interrogation_Position=235; Antisense; GGTCAACGGTGTGTTCCTGTACAAA
>probe:Drosophila_2:1634720_at:242:519; Interrogation_Position=289; Antisense; GTGGACTCTGGACTGCAAGAACGCC
>probe:Drosophila_2:1634720_at:417:381; Interrogation_Position=307; Antisense; GAACGCCAAGGCCTACGAGGGACCT
>probe:Drosophila_2:1634720_at:525:321; Interrogation_Position=332; Antisense; GCCCAGGGCATCAAGGTGGACACCA
>probe:Drosophila_2:1634720_at:38:633; Interrogation_Position=366; Antisense; TCGCCGACGAGGACATGGTTGACAT
>probe:Drosophila_2:1634720_at:584:725; Interrogation_Position=384; Antisense; TTGACATCGCCCTGGGCAAGCTGAA
>probe:Drosophila_2:1634720_at:28:361; Interrogation_Position=432; Antisense; GCAAGCTGAAGATCGCCGGCAACAT
>probe:Drosophila_2:1634720_at:128:567; Interrogation_Position=449; Antisense; GGCAACATCATGCTCACCCAGAAGC
>probe:Drosophila_2:1634720_at:332:85; Interrogation_Position=515; Antisense; AGTGATCAACAATAACCCAGCCCAG
>probe:Drosophila_2:1634720_at:282:93; Interrogation_Position=538; Antisense; AGTTAGCACATTCCTCAACGAGACA
>probe:Drosophila_2:1634720_at:251:151; Interrogation_Position=560; Antisense; ACAGTGTGTGTGTGTTCCCTTTTAC
>probe:Drosophila_2:1634720_at:623:481; Interrogation_Position=624; Antisense; GTATTCGTGTTTTTGTTTCACCACA

Paste this into a BLAST search page for me
CAACAACCATGTCTCTGCAGTCGGATCGGACGCCGTTTTCCAAAAGATCAGGTCAACGGTGTGTTCCTGTACAAAGTGGACTCTGGACTGCAAGAACGCCGAACGCCAAGGCCTACGAGGGACCTGCCCAGGGCATCAAGGTGGACACCATCGCCGACGAGGACATGGTTGACATTTGACATCGCCCTGGGCAAGCTGAAGCAAGCTGAAGATCGCCGGCAACATGGCAACATCATGCTCACCCAGAAGCAGTGATCAACAATAACCCAGCCCAGAGTTAGCACATTCCTCAACGAGACAACAGTGTGTGTGTGTTCCCTTTTACGTATTCGTGTTTTTGTTTCACCACA

Full Affymetrix probeset data:

Annotations for 1634720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720