FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634723_at:

>probe:Drosophila_2:1634723_at:260:83; Interrogation_Position=1555; Antisense; AGGGCAAAGTGTATCTCTCGGTCTT
>probe:Drosophila_2:1634723_at:652:33; Interrogation_Position=1589; Antisense; ATCGGGAGGAGGACGTTCCTTCAAT
>probe:Drosophila_2:1634723_at:592:519; Interrogation_Position=1629; Antisense; GTGGACGACAATTTGGCACCCAATA
>probe:Drosophila_2:1634723_at:532:243; Interrogation_Position=1663; Antisense; AATATTTCCACGATGCTGAGGGCGT
>probe:Drosophila_2:1634723_at:368:457; Interrogation_Position=1707; Antisense; GATACGGATGGCTCAATTGTGGATA
>probe:Drosophila_2:1634723_at:67:1; Interrogation_Position=1772; Antisense; ATGCCTGGCCCGCTTGAAAAACGTT
>probe:Drosophila_2:1634723_at:354:181; Interrogation_Position=1788; Antisense; AAAAACGTTTGCAGTGTGGCCTATA
>probe:Drosophila_2:1634723_at:195:521; Interrogation_Position=1803; Antisense; GTGGCCTATAATACCGAACAACTTG
>probe:Drosophila_2:1634723_at:450:573; Interrogation_Position=1827; Antisense; GGCGGTGATCAACCCGACTTTCAAA
>probe:Drosophila_2:1634723_at:212:423; Interrogation_Position=1872; Antisense; GAGAACGATTTGATCTCCGATGGCC
>probe:Drosophila_2:1634723_at:462:287; Interrogation_Position=1906; Antisense; CTGGCATCTTCAACTGTCCGGACGA
>probe:Drosophila_2:1634723_at:492:503; Interrogation_Position=1921; Antisense; GTCCGGACGACTTCATAGCCATCAA
>probe:Drosophila_2:1634723_at:548:425; Interrogation_Position=1986; Antisense; GAGAGCGACGACTATACCATCCATG
>probe:Drosophila_2:1634723_at:142:719; Interrogation_Position=2052; Antisense; TTCCGTACCGATTCCGAGTATGTGG

Paste this into a BLAST search page for me
AGGGCAAAGTGTATCTCTCGGTCTTATCGGGAGGAGGACGTTCCTTCAATGTGGACGACAATTTGGCACCCAATAAATATTTCCACGATGCTGAGGGCGTGATACGGATGGCTCAATTGTGGATAATGCCTGGCCCGCTTGAAAAACGTTAAAAACGTTTGCAGTGTGGCCTATAGTGGCCTATAATACCGAACAACTTGGGCGGTGATCAACCCGACTTTCAAAGAGAACGATTTGATCTCCGATGGCCCTGGCATCTTCAACTGTCCGGACGAGTCCGGACGACTTCATAGCCATCAAGAGAGCGACGACTATACCATCCATGTTCCGTACCGATTCCGAGTATGTGG

Full Affymetrix probeset data:

Annotations for 1634723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720