Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634724_at:

>probe:Drosophila_2:1634724_at:391:151; Interrogation_Position=5602; Antisense; ACATGCGTCAAAATTCCCGGAGCTG
>probe:Drosophila_2:1634724_at:247:591; Interrogation_Position=5666; Antisense; TGGTGGGCGTAATCCGCGACACAGA
>probe:Drosophila_2:1634724_at:359:397; Interrogation_Position=5683; Antisense; GACACAGAGTTCCATCAGTTCGATA
>probe:Drosophila_2:1634724_at:670:685; Interrogation_Position=5706; Antisense; TATCATCGAGGGTGTCATCAGCATC
>probe:Drosophila_2:1634724_at:310:185; Interrogation_Position=5734; Antisense; AACAATCTGTGGTATGCCTTGGCCG
>probe:Drosophila_2:1634724_at:194:561; Interrogation_Position=5769; Antisense; GGAACTGACGGATTACGACCACATC
>probe:Drosophila_2:1634724_at:327:133; Interrogation_Position=5783; Antisense; ACGACCACATCCAGTTGCGAGTTTA
>probe:Drosophila_2:1634724_at:20:93; Interrogation_Position=5802; Antisense; AGTTTACCGTCTGGTGTTGCAGCTA
>probe:Drosophila_2:1634724_at:109:141; Interrogation_Position=5844; Antisense; ACGGATATCAGTTCCTGGCTTGGGT
>probe:Drosophila_2:1634724_at:287:503; Interrogation_Position=5867; Antisense; GTCGCCTGTTCAACGTTCTGTGGAA
>probe:Drosophila_2:1634724_at:386:715; Interrogation_Position=5882; Antisense; TTCTGTGGAAAACTGGCTCGGCCTG
>probe:Drosophila_2:1634724_at:13:683; Interrogation_Position=5998; Antisense; TATGTACGGAGCTTTGGCAGCGCTG
>probe:Drosophila_2:1634724_at:482:365; Interrogation_Position=6040; Antisense; GAATACTGCGACTGGCTGGCCAAGG
>probe:Drosophila_2:1634724_at:263:61; Interrogation_Position=6116; Antisense; ATGTCATTGACTGGGCGCAAGCGCA

Paste this into a BLAST search page for me
ACATGCGTCAAAATTCCCGGAGCTGTGGTGGGCGTAATCCGCGACACAGAGACACAGAGTTCCATCAGTTCGATATATCATCGAGGGTGTCATCAGCATCAACAATCTGTGGTATGCCTTGGCCGGGAACTGACGGATTACGACCACATCACGACCACATCCAGTTGCGAGTTTAAGTTTACCGTCTGGTGTTGCAGCTAACGGATATCAGTTCCTGGCTTGGGTGTCGCCTGTTCAACGTTCTGTGGAATTCTGTGGAAAACTGGCTCGGCCTGTATGTACGGAGCTTTGGCAGCGCTGGAATACTGCGACTGGCTGGCCAAGGATGTCATTGACTGGGCGCAAGCGCA

Full Affymetrix probeset data:

Annotations for 1634724_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime