FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634725_at:

>probe:Drosophila_2:1634725_at:234:611; Interrogation_Position=2246; Antisense; TGACCTAAGCCGGACCACCAAGATG
>probe:Drosophila_2:1634725_at:9:129; Interrogation_Position=2262; Antisense; ACCAAGATGGCAGATGGCACCCCAT
>probe:Drosophila_2:1634725_at:221:11; Interrogation_Position=2285; Antisense; ATTCGACTCGATTCAATTAACAAAG
>probe:Drosophila_2:1634725_at:479:19; Interrogation_Position=2383; Antisense; ATATCCTTAGTTCTTAAGCGACGAG
>probe:Drosophila_2:1634725_at:512:481; Interrogation_Position=2505; Antisense; GTATTAAAAACAGATCCCATTCGGA
>probe:Drosophila_2:1634725_at:494:177; Interrogation_Position=2540; Antisense; AAACTCATGCGCAGAGAGATGCACA
>probe:Drosophila_2:1634725_at:272:687; Interrogation_Position=2613; Antisense; TATATATGACATATCCCCGCCCATC
>probe:Drosophila_2:1634725_at:280:1; Interrogation_Position=2635; Antisense; ATCGTTCCCGAATAAAGCCCAGCTA
>probe:Drosophila_2:1634725_at:204:301; Interrogation_Position=2652; Antisense; CCCAGCTAAGGGTTCGTTGTGCGTA
>probe:Drosophila_2:1634725_at:604:471; Interrogation_Position=2663; Antisense; GTTCGTTGTGCGTAATTTCTGTGTA
>probe:Drosophila_2:1634725_at:404:675; Interrogation_Position=2713; Antisense; TAGGGCAAACTTTGGACTTTTGTCA
>probe:Drosophila_2:1634725_at:730:59; Interrogation_Position=2742; Antisense; ATGTCTGAGTGGCATCAATTTCGAA
>probe:Drosophila_2:1634725_at:518:293; Interrogation_Position=2762; Antisense; TCGAATGGTAGCTGGAAACTTTCCC
>probe:Drosophila_2:1634725_at:306:559; Interrogation_Position=2775; Antisense; GGAAACTTTCCCATAACAGATGCTA

Paste this into a BLAST search page for me
TGACCTAAGCCGGACCACCAAGATGACCAAGATGGCAGATGGCACCCCATATTCGACTCGATTCAATTAACAAAGATATCCTTAGTTCTTAAGCGACGAGGTATTAAAAACAGATCCCATTCGGAAAACTCATGCGCAGAGAGATGCACATATATATGACATATCCCCGCCCATCATCGTTCCCGAATAAAGCCCAGCTACCCAGCTAAGGGTTCGTTGTGCGTAGTTCGTTGTGCGTAATTTCTGTGTATAGGGCAAACTTTGGACTTTTGTCAATGTCTGAGTGGCATCAATTTCGAATCGAATGGTAGCTGGAAACTTTCCCGGAAACTTTCCCATAACAGATGCTA

Full Affymetrix probeset data:

Annotations for 1634725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720