Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634726_s_at:

>probe:Drosophila_2:1634726_s_at:286:65; Interrogation_Position=312; Antisense; ATGGGAGTACGGATCTGCTTTGGAA
>probe:Drosophila_2:1634726_s_at:502:675; Interrogation_Position=416; Antisense; TAGCGCTGCTCTTCCTGGATAGGGA
>probe:Drosophila_2:1634726_s_at:145:529; Interrogation_Position=437; Antisense; GGGAGTTCCCACTAACATACAAGAT
>probe:Drosophila_2:1634726_s_at:564:1; Interrogation_Position=469; Antisense; ATTTGTTTGCCCACCCAGAAAAGAT
>probe:Drosophila_2:1634726_s_at:67:389; Interrogation_Position=486; Antisense; GAAAAGATCGCTATCTTCCACTCGC
>probe:Drosophila_2:1634726_s_at:532:509; Interrogation_Position=545; Antisense; GTGACACGCATTACGGAGGCGTCCT
>probe:Drosophila_2:1634726_s_at:386:699; Interrogation_Position=582; Antisense; TTTACCTATTGTACCCAGGCATATC
>probe:Drosophila_2:1634726_s_at:362:23; Interrogation_Position=602; Antisense; ATATCTGTCAGGATCAGCTTCGCAA
>probe:Drosophila_2:1634726_s_at:258:343; Interrogation_Position=618; Antisense; GCTTCGCAAAACTAGGCTGGGCCAA
>probe:Drosophila_2:1634726_s_at:328:179; Interrogation_Position=642; Antisense; AAACTATACACTGCCTCGTGGGTTA
>probe:Drosophila_2:1634726_s_at:563:557; Interrogation_Position=687; Antisense; GGACAATGATGCTTGCACCGGCGAT
>probe:Drosophila_2:1634726_s_at:273:567; Interrogation_Position=720; Antisense; GGCACTTTTCTGTCCAATGACCGAG
>probe:Drosophila_2:1634726_s_at:123:437; Interrogation_Position=742; Antisense; GAGGATCCCAAACAGTTCGAGCAAA
>probe:Drosophila_2:1634726_s_at:356:471; Interrogation_Position=808; Antisense; GTTCCCGCCACTTATACAGATGTTT

Paste this into a BLAST search page for me
ATGGGAGTACGGATCTGCTTTGGAATAGCGCTGCTCTTCCTGGATAGGGAGGGAGTTCCCACTAACATACAAGATATTTGTTTGCCCACCCAGAAAAGATGAAAAGATCGCTATCTTCCACTCGCGTGACACGCATTACGGAGGCGTCCTTTTACCTATTGTACCCAGGCATATCATATCTGTCAGGATCAGCTTCGCAAGCTTCGCAAAACTAGGCTGGGCCAAAAACTATACACTGCCTCGTGGGTTAGGACAATGATGCTTGCACCGGCGATGGCACTTTTCTGTCCAATGACCGAGGAGGATCCCAAACAGTTCGAGCAAAGTTCCCGCCACTTATACAGATGTTT

Full Affymetrix probeset data:

Annotations for 1634726_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime