Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634728_at:

>probe:Drosophila_2:1634728_at:79:65; Interrogation_Position=511; Antisense; ATGGGCACTTACTATCTTTTTATTA
>probe:Drosophila_2:1634728_at:318:179; Interrogation_Position=538; Antisense; AAACTATACGATTTCCGCTGCATGA
>probe:Drosophila_2:1634728_at:710:621; Interrogation_Position=566; Antisense; TGCTGTCCTCGGATCATCCAGATAA
>probe:Drosophila_2:1634728_at:487:449; Interrogation_Position=598; Antisense; GATCGTTTGTTGACCTACTTTTACT
>probe:Drosophila_2:1634728_at:482:209; Interrogation_Position=682; Antisense; AAGCAAATCACCGTACTCCATGTAT
>probe:Drosophila_2:1634728_at:225:533; Interrogation_Position=729; Antisense; GGGTGTGCCATTGACATACTATTTC
>probe:Drosophila_2:1634728_at:495:529; Interrogation_Position=783; Antisense; GGGATATCTCAACTCATTTGTACAT
>probe:Drosophila_2:1634728_at:149:513; Interrogation_Position=811; Antisense; GTGATGTACGCCTACTATTTCGCAT
>probe:Drosophila_2:1634728_at:454:691; Interrogation_Position=828; Antisense; TTTCGCATCTGCTTGGTATCCAAAC
>probe:Drosophila_2:1634728_at:425:101; Interrogation_Position=876; Antisense; AGAGTACATCACCAAGCTGCAGTTC
>probe:Drosophila_2:1634728_at:18:617; Interrogation_Position=893; Antisense; TGCAGTTCCTACAGTTCATGATCCT
>probe:Drosophila_2:1634728_at:35:401; Interrogation_Position=936; Antisense; GACATTGTGGCTAAATCCCGGTTGC
>probe:Drosophila_2:1634728_at:458:223; Interrogation_Position=970; Antisense; AAGGTCCTGCAGTACGTTCAGCTGG
>probe:Drosophila_2:1634728_at:211:435; Interrogation_Position=995; Antisense; GAGGTTCCGTTTCCATGATGACCAT

Paste this into a BLAST search page for me
ATGGGCACTTACTATCTTTTTATTAAAACTATACGATTTCCGCTGCATGATGCTGTCCTCGGATCATCCAGATAAGATCGTTTGTTGACCTACTTTTACTAAGCAAATCACCGTACTCCATGTATGGGTGTGCCATTGACATACTATTTCGGGATATCTCAACTCATTTGTACATGTGATGTACGCCTACTATTTCGCATTTTCGCATCTGCTTGGTATCCAAACAGAGTACATCACCAAGCTGCAGTTCTGCAGTTCCTACAGTTCATGATCCTGACATTGTGGCTAAATCCCGGTTGCAAGGTCCTGCAGTACGTTCAGCTGGGAGGTTCCGTTTCCATGATGACCAT

Full Affymetrix probeset data:

Annotations for 1634728_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime