FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634729_at:

>probe:Drosophila_2:1634729_at:589:465; Interrogation_Position=1238; Antisense; GATTGTCTGCGCCTCGATCAGCGAA
>probe:Drosophila_2:1634729_at:258:453; Interrogation_Position=1253; Antisense; GATCAGCGAACTTTTGCGCAACCAT
>probe:Drosophila_2:1634729_at:495:219; Interrogation_Position=1303; Antisense; AAGTGGAGGCAGTTACCCAGGCCGA
>probe:Drosophila_2:1634729_at:434:55; Interrogation_Position=1387; Antisense; ATGAGACGCAAGCTATGGGCAATTC
>probe:Drosophila_2:1634729_at:284:527; Interrogation_Position=1403; Antisense; GGGCAATTCGGAGCAATTCGTAGAC
>probe:Drosophila_2:1634729_at:533:635; Interrogation_Position=1517; Antisense; TCGGGAGCGATGATTTCACCAACTA
>probe:Drosophila_2:1634729_at:165:79; Interrogation_Position=1541; Antisense; AGGTCATCTAGACACCACCAAGACA
>probe:Drosophila_2:1634729_at:94:211; Interrogation_Position=1560; Antisense; AAGACACTGCTCATCCTTGGGAGAC
>probe:Drosophila_2:1634729_at:388:159; Interrogation_Position=1610; Antisense; ACAACTCTTAGTGCCGTCTACATAG
>probe:Drosophila_2:1634729_at:596:25; Interrogation_Position=1631; Antisense; ATAGTCTTTCTTGTGATCCATCATA
>probe:Drosophila_2:1634729_at:14:225; Interrogation_Position=1694; Antisense; AAGGATCCAGTTTTGTTAGGTGACA
>probe:Drosophila_2:1634729_at:243:535; Interrogation_Position=1712; Antisense; GGTGACATTCTTCAGCTTTTAATAA
>probe:Drosophila_2:1634729_at:697:151; Interrogation_Position=1738; Antisense; ACATGTTCACCTACGTTGAATCCAA
>probe:Drosophila_2:1634729_at:414:367; Interrogation_Position=1755; Antisense; GAATCCAATTACTTTCACCTTATTT

Paste this into a BLAST search page for me
GATTGTCTGCGCCTCGATCAGCGAAGATCAGCGAACTTTTGCGCAACCATAAGTGGAGGCAGTTACCCAGGCCGAATGAGACGCAAGCTATGGGCAATTCGGGCAATTCGGAGCAATTCGTAGACTCGGGAGCGATGATTTCACCAACTAAGGTCATCTAGACACCACCAAGACAAAGACACTGCTCATCCTTGGGAGACACAACTCTTAGTGCCGTCTACATAGATAGTCTTTCTTGTGATCCATCATAAAGGATCCAGTTTTGTTAGGTGACAGGTGACATTCTTCAGCTTTTAATAAACATGTTCACCTACGTTGAATCCAAGAATCCAATTACTTTCACCTTATTT

Full Affymetrix probeset data:

Annotations for 1634729_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720