Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634731_at:

>probe:Drosophila_2:1634731_at:397:417; Interrogation_Position=1106; Antisense; GAGCTTAACATCTTGAACATCGGGC
>probe:Drosophila_2:1634731_at:496:703; Interrogation_Position=1189; Antisense; TTCTGTTCCCGCCATGGGTAGGGAA
>probe:Drosophila_2:1634731_at:159:197; Interrogation_Position=1238; Antisense; AACGGTCTCATCTTGCCAAAGGGCT
>probe:Drosophila_2:1634731_at:114:169; Interrogation_Position=1255; Antisense; AAAGGGCTCCCAGATTTTTGTCCAT
>probe:Drosophila_2:1634731_at:249:703; Interrogation_Position=1270; Antisense; TTTTGTCCATGTCTTCGACATCCAT
>probe:Drosophila_2:1634731_at:204:593; Interrogation_Position=1310; Antisense; TGGGATTCTCCCGAAGAGTTTCGCC
>probe:Drosophila_2:1634731_at:721:429; Interrogation_Position=1325; Antisense; GAGTTTCGCCCGGAGAGATTTCTGC
>probe:Drosophila_2:1634731_at:469:387; Interrogation_Position=1352; Antisense; GAAAACTCGCAGAATCGTCACACCT
>probe:Drosophila_2:1634731_at:95:157; Interrogation_Position=1371; Antisense; ACACCTACGCATATATTCCATTCAG
>probe:Drosophila_2:1634731_at:315:229; Interrogation_Position=1453; Antisense; AATGGTGGCCCTACTGAAGCAGTTC
>probe:Drosophila_2:1634731_at:189:377; Interrogation_Position=1468; Antisense; GAAGCAGTTCCAAATTCTACCAGAA
>probe:Drosophila_2:1634731_at:261:711; Interrogation_Position=1515; Antisense; TTCAAACTGGACTAACACTGCGGAC
>probe:Drosophila_2:1634731_at:345:623; Interrogation_Position=1533; Antisense; TGCGGACCAAGAACCAGATTCACGT
>probe:Drosophila_2:1634731_at:244:601; Interrogation_Position=1602; Antisense; TGTTCACGGAACTCTGTTAGTCATA

Paste this into a BLAST search page for me
GAGCTTAACATCTTGAACATCGGGCTTCTGTTCCCGCCATGGGTAGGGAAAACGGTCTCATCTTGCCAAAGGGCTAAAGGGCTCCCAGATTTTTGTCCATTTTTGTCCATGTCTTCGACATCCATTGGGATTCTCCCGAAGAGTTTCGCCGAGTTTCGCCCGGAGAGATTTCTGCGAAAACTCGCAGAATCGTCACACCTACACCTACGCATATATTCCATTCAGAATGGTGGCCCTACTGAAGCAGTTCGAAGCAGTTCCAAATTCTACCAGAATTCAAACTGGACTAACACTGCGGACTGCGGACCAAGAACCAGATTCACGTTGTTCACGGAACTCTGTTAGTCATA

Full Affymetrix probeset data:

Annotations for 1634731_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime