FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634733_at:

>probe:Drosophila_2:1634733_at:514:81; Interrogation_Position=1039; Antisense; AGGGAAGTCCTCGAATTCCGCAAGC
>probe:Drosophila_2:1634733_at:658:239; Interrogation_Position=1078; Antisense; AATCAGCACGTGTCTATTCCAGTGT
>probe:Drosophila_2:1634733_at:438:9; Interrogation_Position=1093; Antisense; ATTCCAGTGTGCTTCCTGATTGTAA
>probe:Drosophila_2:1634733_at:625:315; Interrogation_Position=1132; Antisense; GCCTTCGCGGGATTGGTGTACCTAT
>probe:Drosophila_2:1634733_at:218:75; Interrogation_Position=1160; Antisense; AGGACTTTGATTTCCACTACTGCGC
>probe:Drosophila_2:1634733_at:116:379; Interrogation_Position=1188; Antisense; GAAGCTCGTCCTGCTAAATATTGCG
>probe:Drosophila_2:1634733_at:615:7; Interrogation_Position=1207; Antisense; ATTGCGAACGTGATGCTGTGGCTAT
>probe:Drosophila_2:1634733_at:308:277; Interrogation_Position=1248; Antisense; CTTTTTCGTGGCATCATCGGTGACT
>probe:Drosophila_2:1634733_at:680:531; Interrogation_Position=1266; Antisense; GGTGACTCGAGTGTGCCAGAATGCT
>probe:Drosophila_2:1634733_at:415:541; Interrogation_Position=1314; Antisense; GGTTCGTCCATTTGTTTACCACAAT
>probe:Drosophila_2:1634733_at:701:27; Interrogation_Position=1337; Antisense; ATACCTCAGCGGAAGATCTCAACTC
>probe:Drosophila_2:1634733_at:72:61; Interrogation_Position=1390; Antisense; ATGTCCGCCAAACTCTTTCGAATGC
>probe:Drosophila_2:1634733_at:33:647; Interrogation_Position=1457; Antisense; TCATTGTGATTCTCACGCTGGGCAT
>probe:Drosophila_2:1634733_at:523:53; Interrogation_Position=976; Antisense; ATGCATCTGGAAACGCTGTCGCACA

Paste this into a BLAST search page for me
AGGGAAGTCCTCGAATTCCGCAAGCAATCAGCACGTGTCTATTCCAGTGTATTCCAGTGTGCTTCCTGATTGTAAGCCTTCGCGGGATTGGTGTACCTATAGGACTTTGATTTCCACTACTGCGCGAAGCTCGTCCTGCTAAATATTGCGATTGCGAACGTGATGCTGTGGCTATCTTTTTCGTGGCATCATCGGTGACTGGTGACTCGAGTGTGCCAGAATGCTGGTTCGTCCATTTGTTTACCACAATATACCTCAGCGGAAGATCTCAACTCATGTCCGCCAAACTCTTTCGAATGCTCATTGTGATTCTCACGCTGGGCATATGCATCTGGAAACGCTGTCGCACA

Full Affymetrix probeset data:

Annotations for 1634733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720