FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634734_at:

>probe:Drosophila_2:1634734_at:180:307; Interrogation_Position=2562; Antisense; CCTCAACATTATTTCTGCCTATCTG
>probe:Drosophila_2:1634734_at:318:519; Interrogation_Position=2651; Antisense; GTGGTTCGGAGATTCTACTCGTGAT
>probe:Drosophila_2:1634734_at:617:1; Interrogation_Position=2686; Antisense; GGTCAGGAGTTTGCCGGAACTACAT
>probe:Drosophila_2:1634734_at:56:91; Interrogation_Position=2720; Antisense; AGTTTTACCTTAAATCGCCGCATCG
>probe:Drosophila_2:1634734_at:569:319; Interrogation_Position=2736; Antisense; GCCGCATCGTCAGCAAACATCGTAT
>probe:Drosophila_2:1634734_at:572:221; Interrogation_Position=2817; Antisense; AATGGTTCCCCGTGGACATATCTAT
>probe:Drosophila_2:1634734_at:278:407; Interrogation_Position=2879; Antisense; GACGGTATCCATCGTGGTACTGTCG
>probe:Drosophila_2:1634734_at:645:537; Interrogation_Position=2894; Antisense; GGTACTGTCGCTCCATAACAGTGGT
>probe:Drosophila_2:1634734_at:91:93; Interrogation_Position=2934; Antisense; AGTTCAGCAGCTATTCCTCGTAGAG
>probe:Drosophila_2:1634734_at:25:227; Interrogation_Position=2969; Antisense; AAGGCGGGAGTCACATACAGTTTAT
>probe:Drosophila_2:1634734_at:362:685; Interrogation_Position=3040; Antisense; TATACGTGGTGCAAGCGGTTCCGGA
>probe:Drosophila_2:1634734_at:297:351; Interrogation_Position=3070; Antisense; GCAGAGCAGCTTTATTTCAGTTGGT
>probe:Drosophila_2:1634734_at:472:13; Interrogation_Position=3100; Antisense; ATTAATGCAATAACCGGGCCATCGC
>probe:Drosophila_2:1634734_at:402:579; Interrogation_Position=3116; Antisense; GGCCATCGCAAACACACGGTATCTA

Paste this into a BLAST search page for me
CCTCAACATTATTTCTGCCTATCTGGTGGTTCGGAGATTCTACTCGTGATGGTCAGGAGTTTGCCGGAACTACATAGTTTTACCTTAAATCGCCGCATCGGCCGCATCGTCAGCAAACATCGTATAATGGTTCCCCGTGGACATATCTATGACGGTATCCATCGTGGTACTGTCGGGTACTGTCGCTCCATAACAGTGGTAGTTCAGCAGCTATTCCTCGTAGAGAAGGCGGGAGTCACATACAGTTTATTATACGTGGTGCAAGCGGTTCCGGAGCAGAGCAGCTTTATTTCAGTTGGTATTAATGCAATAACCGGGCCATCGCGGCCATCGCAAACACACGGTATCTA

Full Affymetrix probeset data:

Annotations for 1634734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720