FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634737_at:

>probe:Drosophila_2:1634737_at:667:415; Interrogation_Position=3024; Antisense; GAGCGATCGCCCAGTGTTAGCATGG
>probe:Drosophila_2:1634737_at:265:155; Interrogation_Position=3055; Antisense; ACAGCTCCTCGCAGTCTCGGGAAAA
>probe:Drosophila_2:1634737_at:589:543; Interrogation_Position=3074; Antisense; GGAAAACTCCCAGCCCAGAAGTACT
>probe:Drosophila_2:1634737_at:549:551; Interrogation_Position=3113; Antisense; GGAGAGCAGCCCTAGAATGCCCAGG
>probe:Drosophila_2:1634737_at:93:77; Interrogation_Position=3148; Antisense; AGGAGATTCCTCTCGAGGACTTCCA
>probe:Drosophila_2:1634737_at:135:75; Interrogation_Position=3163; Antisense; AGGACTTCCAGCACTCACGGAACAA
>probe:Drosophila_2:1634737_at:20:147; Interrogation_Position=3253; Antisense; ACTACGATCAGCTGTCCGGTCATAG
>probe:Drosophila_2:1634737_at:600:535; Interrogation_Position=3270; Antisense; GGTCATAGCGGCTCACCACGTGAAG
>probe:Drosophila_2:1634737_at:379:659; Interrogation_Position=3311; Antisense; TAACGCCCTGCTAAGCCAGTTAAAT
>probe:Drosophila_2:1634737_at:730:167; Interrogation_Position=3332; Antisense; AAATGGGCTGAACCGTGAAGTGCTC
>probe:Drosophila_2:1634737_at:450:417; Interrogation_Position=3365; Antisense; GAGCTCCGAGGAGACTTCTTTTATT
>probe:Drosophila_2:1634737_at:519:401; Interrogation_Position=3377; Antisense; GACTTCTTTTATTGGGAGCGACGGA
>probe:Drosophila_2:1634737_at:159:353; Interrogation_Position=3491; Antisense; GCAGCCTTATGCTTAGATTGTTGCT
>probe:Drosophila_2:1634737_at:318:533; Interrogation_Position=3545; Antisense; GGTGGTACATACTCTAATTCCTTTT

Paste this into a BLAST search page for me
GAGCGATCGCCCAGTGTTAGCATGGACAGCTCCTCGCAGTCTCGGGAAAAGGAAAACTCCCAGCCCAGAAGTACTGGAGAGCAGCCCTAGAATGCCCAGGAGGAGATTCCTCTCGAGGACTTCCAAGGACTTCCAGCACTCACGGAACAAACTACGATCAGCTGTCCGGTCATAGGGTCATAGCGGCTCACCACGTGAAGTAACGCCCTGCTAAGCCAGTTAAATAAATGGGCTGAACCGTGAAGTGCTCGAGCTCCGAGGAGACTTCTTTTATTGACTTCTTTTATTGGGAGCGACGGAGCAGCCTTATGCTTAGATTGTTGCTGGTGGTACATACTCTAATTCCTTTT

Full Affymetrix probeset data:

Annotations for 1634737_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720