FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634740_at:

>probe:Drosophila_2:1634740_at:97:23; Interrogation_Position=2347; Antisense; ATATGGGTGTACAGACATTATATAC
>probe:Drosophila_2:1634740_at:65:23; Interrogation_Position=2380; Antisense; ATATATACATACTTGCATGCATTGT
>probe:Drosophila_2:1634740_at:644:347; Interrogation_Position=2394; Antisense; GCATGCATTGTATTTGCGACTCTAC
>probe:Drosophila_2:1634740_at:448:717; Interrogation_Position=2407; Antisense; TTGCGACTCTACTTAAGGCAAGTCC
>probe:Drosophila_2:1634740_at:278:67; Interrogation_Position=2422; Antisense; AGGCAAGTCCACCTTTTGGACTGGC
>probe:Drosophila_2:1634740_at:251:653; Interrogation_Position=2455; Antisense; TAATCGCAATCTCTCGGTTTCTGTT
>probe:Drosophila_2:1634740_at:669:539; Interrogation_Position=2470; Antisense; GGTTTCTGTTGCTGCATGTTCTTAA
>probe:Drosophila_2:1634740_at:551:469; Interrogation_Position=2477; Antisense; GTTGCTGCATGTTCTTAATACTATT
>probe:Drosophila_2:1634740_at:83:709; Interrogation_Position=2491; Antisense; TTAATACTATTTCACCTAGCTCCCC
>probe:Drosophila_2:1634740_at:600:301; Interrogation_Position=2518; Antisense; CCCTCCCCACATATTATATTCAATT
>probe:Drosophila_2:1634740_at:121:265; Interrogation_Position=2584; Antisense; CAGATTGTAATCTATTTAGGCAAGT
>probe:Drosophila_2:1634740_at:365:361; Interrogation_Position=2603; Antisense; GCAAGTGGTAGGGTATCTCTAGCAT
>probe:Drosophila_2:1634740_at:558:485; Interrogation_Position=2610; Antisense; GTAGGGTATCTCTAGCATTAGAAGA
>probe:Drosophila_2:1634740_at:548:125; Interrogation_Position=2662; Antisense; ACCAAAATTTTTTCTCTAGGATCAT

Paste this into a BLAST search page for me
ATATGGGTGTACAGACATTATATACATATATACATACTTGCATGCATTGTGCATGCATTGTATTTGCGACTCTACTTGCGACTCTACTTAAGGCAAGTCCAGGCAAGTCCACCTTTTGGACTGGCTAATCGCAATCTCTCGGTTTCTGTTGGTTTCTGTTGCTGCATGTTCTTAAGTTGCTGCATGTTCTTAATACTATTTTAATACTATTTCACCTAGCTCCCCCCCTCCCCACATATTATATTCAATTCAGATTGTAATCTATTTAGGCAAGTGCAAGTGGTAGGGTATCTCTAGCATGTAGGGTATCTCTAGCATTAGAAGAACCAAAATTTTTTCTCTAGGATCAT

Full Affymetrix probeset data:

Annotations for 1634740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720