Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634742_at:

>probe:Drosophila_2:1634742_at:83:147; Interrogation_Position=1048; Antisense; ACTACGACATCACGGAGACGGCTGA
>probe:Drosophila_2:1634742_at:586:407; Interrogation_Position=1064; Antisense; GACGGCTGAGGCGTTTGAGACCTCC
>probe:Drosophila_2:1634742_at:353:129; Interrogation_Position=1098; Antisense; ACCGGTGGCGCTATCAAGGTCATGA
>probe:Drosophila_2:1634742_at:489:23; Interrogation_Position=1192; Antisense; ATAGTTCTTATTTTTGGAGCCTTGG
>probe:Drosophila_2:1634742_at:137:553; Interrogation_Position=1207; Antisense; GGAGCCTTGGAGCAATTCCGAGCTT
>probe:Drosophila_2:1634742_at:723:417; Interrogation_Position=1226; Antisense; GAGCTTGGTTTGTTATCGCCTTCAA
>probe:Drosophila_2:1634742_at:649:43; Interrogation_Position=1240; Antisense; ATCGCCTTCAAATTTTTCGCCTATA
>probe:Drosophila_2:1634742_at:531:727; Interrogation_Position=1271; Antisense; TTGGCTGCTGACTTATGTACCTACA
>probe:Drosophila_2:1634742_at:125:79; Interrogation_Position=775; Antisense; AGGTGGTTCACCAGACGATGAGCGA
>probe:Drosophila_2:1634742_at:499:63; Interrogation_Position=897; Antisense; ATGGGTGCACCCGAGGTCAAGCTGC
>probe:Drosophila_2:1634742_at:541:199; Interrogation_Position=930; Antisense; AACGCTTTGGCACGTGAGATCGACA
>probe:Drosophila_2:1634742_at:601:97; Interrogation_Position=946; Antisense; AGATCGACATTCGTGGTGTCTTCCG
>probe:Drosophila_2:1634742_at:417:669; Interrogation_Position=972; Antisense; TACTGCAATGATTATTCCGCCGCTT
>probe:Drosophila_2:1634742_at:543:277; Interrogation_Position=994; Antisense; CTTTGGCTCTGGTGGCTTCGGGCAA

Paste this into a BLAST search page for me
ACTACGACATCACGGAGACGGCTGAGACGGCTGAGGCGTTTGAGACCTCCACCGGTGGCGCTATCAAGGTCATGAATAGTTCTTATTTTTGGAGCCTTGGGGAGCCTTGGAGCAATTCCGAGCTTGAGCTTGGTTTGTTATCGCCTTCAAATCGCCTTCAAATTTTTCGCCTATATTGGCTGCTGACTTATGTACCTACAAGGTGGTTCACCAGACGATGAGCGAATGGGTGCACCCGAGGTCAAGCTGCAACGCTTTGGCACGTGAGATCGACAAGATCGACATTCGTGGTGTCTTCCGTACTGCAATGATTATTCCGCCGCTTCTTTGGCTCTGGTGGCTTCGGGCAA

Full Affymetrix probeset data:

Annotations for 1634742_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime