Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634746_at:

>probe:Drosophila_2:1634746_at:229:421; Interrogation_Position=1200; Antisense; GAGCAATGCTGCGTGCGACTGGCCA
>probe:Drosophila_2:1634746_at:541:297; Interrogation_Position=1244; Antisense; GCAAATGGTGTACAACGCCGGGTTT
>probe:Drosophila_2:1634746_at:451:689; Interrogation_Position=1266; Antisense; TTTCCCTACTACGTTAACTTCAGCT
>probe:Drosophila_2:1634746_at:538:709; Interrogation_Position=1279; Antisense; TTAACTTCAGCTTCAGGCACGACTT
>probe:Drosophila_2:1634746_at:447:401; Interrogation_Position=1299; Antisense; GACTTCAACCCTTCGATTTTTCAAG
>probe:Drosophila_2:1634746_at:185:587; Interrogation_Position=1388; Antisense; TGGAGGACCGATGTTCGACCAGAAT
>probe:Drosophila_2:1634746_at:83:67; Interrogation_Position=1411; Antisense; ATGGATGCATCCTAGGCGTTTGTGT
>probe:Drosophila_2:1634746_at:181:295; Interrogation_Position=1454; Antisense; CGACGTCGTCTACCCAAACATAAAT
>probe:Drosophila_2:1634746_at:175:727; Interrogation_Position=1493; Antisense; TTGTGATATCCGCAACACGTTGCAG
>probe:Drosophila_2:1634746_at:695:479; Interrogation_Position=1520; Antisense; GTTTGCACGCACCAACGACTTAAAT
>probe:Drosophila_2:1634746_at:209:63; Interrogation_Position=1543; Antisense; ATGTGCTTAGCAACCTGGTAGCCAG
>probe:Drosophila_2:1634746_at:687:589; Interrogation_Position=1558; Antisense; TGGTAGCCAGTCCAGATGTACACCG
>probe:Drosophila_2:1634746_at:217:491; Interrogation_Position=1575; Antisense; GTACACCGCGTGTGGTCTCTGGAAA
>probe:Drosophila_2:1634746_at:210:425; Interrogation_Position=1627; Antisense; GAGACTCGTGCATTGTTCATTGTTA

Paste this into a BLAST search page for me
GAGCAATGCTGCGTGCGACTGGCCAGCAAATGGTGTACAACGCCGGGTTTTTTCCCTACTACGTTAACTTCAGCTTTAACTTCAGCTTCAGGCACGACTTGACTTCAACCCTTCGATTTTTCAAGTGGAGGACCGATGTTCGACCAGAATATGGATGCATCCTAGGCGTTTGTGTCGACGTCGTCTACCCAAACATAAATTTGTGATATCCGCAACACGTTGCAGGTTTGCACGCACCAACGACTTAAATATGTGCTTAGCAACCTGGTAGCCAGTGGTAGCCAGTCCAGATGTACACCGGTACACCGCGTGTGGTCTCTGGAAAGAGACTCGTGCATTGTTCATTGTTA

Full Affymetrix probeset data:

Annotations for 1634746_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime