Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634747_at:

>probe:Drosophila_2:1634747_at:191:359; Interrogation_Position=1016; Antisense; GCAACAACTTGCACCGAGCCGAGGG
>probe:Drosophila_2:1634747_at:52:445; Interrogation_Position=1053; Antisense; GATGATGTCTGCGATGTCTCAACGA
>probe:Drosophila_2:1634747_at:632:61; Interrogation_Position=1066; Antisense; ATGTCTCAACGACCTATTCATGACC
>probe:Drosophila_2:1634747_at:348:379; Interrogation_Position=1121; Antisense; GAACCTGCAAACAGGCCTTGGGCAT
>probe:Drosophila_2:1634747_at:633:163; Interrogation_Position=1172; Antisense; AAATAACGGCCAGTTCGGCCCATGA
>probe:Drosophila_2:1634747_at:330:113; Interrogation_Position=1327; Antisense; AGCAGCTCCGGTGCGCAAAACAAAT
>probe:Drosophila_2:1634747_at:252:167; Interrogation_Position=1364; Antisense; AAATGTCACACATGGCGTTTTGCAT
>probe:Drosophila_2:1634747_at:122:323; Interrogation_Position=1392; Antisense; GCGCCCTCTGCTGGGAAGAAATTGC
>probe:Drosophila_2:1634747_at:710:89; Interrogation_Position=1463; Antisense; AGATTTATATCGTGCTTTTCGGCCA
>probe:Drosophila_2:1634747_at:377:341; Interrogation_Position=1476; Antisense; GCTTTTCGGCCACTTGGGAGAACCA
>probe:Drosophila_2:1634747_at:93:379; Interrogation_Position=1495; Antisense; GAACCACCGGAGTCGATGAAACTTA
>probe:Drosophila_2:1634747_at:421:389; Interrogation_Position=1512; Antisense; GAAACTTATTACCTTGCTAGCCTAC
>probe:Drosophila_2:1634747_at:557:339; Interrogation_Position=1527; Antisense; GCTAGCCTACATTTTGAGCTCCAAT
>probe:Drosophila_2:1634747_at:669:429; Interrogation_Position=995; Antisense; GAGTGGGCCTAACCCTTGTCTGCAA

Paste this into a BLAST search page for me
GCAACAACTTGCACCGAGCCGAGGGGATGATGTCTGCGATGTCTCAACGAATGTCTCAACGACCTATTCATGACCGAACCTGCAAACAGGCCTTGGGCATAAATAACGGCCAGTTCGGCCCATGAAGCAGCTCCGGTGCGCAAAACAAATAAATGTCACACATGGCGTTTTGCATGCGCCCTCTGCTGGGAAGAAATTGCAGATTTATATCGTGCTTTTCGGCCAGCTTTTCGGCCACTTGGGAGAACCAGAACCACCGGAGTCGATGAAACTTAGAAACTTATTACCTTGCTAGCCTACGCTAGCCTACATTTTGAGCTCCAATGAGTGGGCCTAACCCTTGTCTGCAA

Full Affymetrix probeset data:

Annotations for 1634747_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime