Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634748_at:

>probe:Drosophila_2:1634748_at:265:211; Interrogation_Position=1468; Antisense; AAGAAGGCTTTCACCTGCGAGATCT
>probe:Drosophila_2:1634748_at:640:95; Interrogation_Position=1487; Antisense; AGATCTGCGGCGTGGGACTGTCTCA
>probe:Drosophila_2:1634748_at:592:437; Interrogation_Position=1500; Antisense; GGGACTGTCTCAGAAGTCGGGCTAC
>probe:Drosophila_2:1634748_at:109:355; Interrogation_Position=1530; Antisense; GCACATGATGGTCCACAGTGGCGTC
>probe:Drosophila_2:1634748_at:50:83; Interrogation_Position=1565; Antisense; AGTGTGATGTTTGCGGGCATGCCTT
>probe:Drosophila_2:1634748_at:434:205; Interrogation_Position=1639; Antisense; AAGCCGTTTAAGTGCGAGGTCTGCG
>probe:Drosophila_2:1634748_at:616:435; Interrogation_Position=1654; Antisense; GAGGTCTGCGTTAAGGCCTTTCCCA
>probe:Drosophila_2:1634748_at:152:577; Interrogation_Position=1668; Antisense; GGCCTTTCCCACAAAGAAGCGACTG
>probe:Drosophila_2:1634748_at:280:89; Interrogation_Position=1696; Antisense; AGTCATATGCGCGTCCACAACAAGG
>probe:Drosophila_2:1634748_at:147:131; Interrogation_Position=1738; Antisense; ACCGTTGCTGTTCAGTCCATCAATC
>probe:Drosophila_2:1634748_at:281:505; Interrogation_Position=1835; Antisense; GTGCGACCGGTGGATCGGCAACCAA
>probe:Drosophila_2:1634748_at:336:373; Interrogation_Position=1873; Antisense; GAAGTTCATGAGCAGCCGGTGTCCA
>probe:Drosophila_2:1634748_at:593:533; Interrogation_Position=1890; Antisense; GGTGTCCACCTCCAAAGTGGTGATG
>probe:Drosophila_2:1634748_at:528:607; Interrogation_Position=1910; Antisense; TGATGGTGCTGTGAGCGGCCACCAA

Paste this into a BLAST search page for me
AAGAAGGCTTTCACCTGCGAGATCTAGATCTGCGGCGTGGGACTGTCTCAGGGACTGTCTCAGAAGTCGGGCTACGCACATGATGGTCCACAGTGGCGTCAGTGTGATGTTTGCGGGCATGCCTTAAGCCGTTTAAGTGCGAGGTCTGCGGAGGTCTGCGTTAAGGCCTTTCCCAGGCCTTTCCCACAAAGAAGCGACTGAGTCATATGCGCGTCCACAACAAGGACCGTTGCTGTTCAGTCCATCAATCGTGCGACCGGTGGATCGGCAACCAAGAAGTTCATGAGCAGCCGGTGTCCAGGTGTCCACCTCCAAAGTGGTGATGTGATGGTGCTGTGAGCGGCCACCAA

Full Affymetrix probeset data:

Annotations for 1634748_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime