FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634750_at:

>probe:Drosophila_2:1634750_at:247:189; Interrogation_Position=120; Antisense; AACAGGCTTCTTGGTTTAGTGCCCT
>probe:Drosophila_2:1634750_at:207:705; Interrogation_Position=135; Antisense; TTAGTGCCCTGACCATCTGCAAAAG
>probe:Drosophila_2:1634750_at:109:431; Interrogation_Position=15; Antisense; GAGTCAAATACTACGCATGCTTTAC
>probe:Drosophila_2:1634750_at:519:173; Interrogation_Position=156; Antisense; AAAGCCTCCACATGTGCTTGGCTGA
>probe:Drosophila_2:1634750_at:238:345; Interrogation_Position=171; Antisense; GCTTGGCTGATCTAAACACCGAAGT
>probe:Drosophila_2:1634750_at:592:129; Interrogation_Position=188; Antisense; ACCGAAGTTACCCTATTCCAGATGA
>probe:Drosophila_2:1634750_at:159:407; Interrogation_Position=230; Antisense; GACGACCACGAGTACTGGTTTGGAT
>probe:Drosophila_2:1634750_at:339:615; Interrogation_Position=255; Antisense; TGAATGCACACGATAAGCCCACCTA
>probe:Drosophila_2:1634750_at:341:125; Interrogation_Position=270; Antisense; AGCCCACCTACAGATACGTTTCGAA
>probe:Drosophila_2:1634750_at:275:53; Interrogation_Position=31; Antisense; ATGCTTTACTGTCTTCCCATTTGGC
>probe:Drosophila_2:1634750_at:511:669; Interrogation_Position=311; Antisense; TACTCGCCGCACAATTCAAAGCTGG
>probe:Drosophila_2:1634750_at:389:635; Interrogation_Position=403; Antisense; TCGCGAACACCGGAGATTCATCTGT
>probe:Drosophila_2:1634750_at:523:393; Interrogation_Position=497; Antisense; GAAAGAGATCTTGTAGCCTACTAAC
>probe:Drosophila_2:1634750_at:669:81; Interrogation_Position=92; Antisense; AGGGCATATGCCTGTATTTCAGTGA

Paste this into a BLAST search page for me
AACAGGCTTCTTGGTTTAGTGCCCTTTAGTGCCCTGACCATCTGCAAAAGGAGTCAAATACTACGCATGCTTTACAAAGCCTCCACATGTGCTTGGCTGAGCTTGGCTGATCTAAACACCGAAGTACCGAAGTTACCCTATTCCAGATGAGACGACCACGAGTACTGGTTTGGATTGAATGCACACGATAAGCCCACCTAAGCCCACCTACAGATACGTTTCGAAATGCTTTACTGTCTTCCCATTTGGCTACTCGCCGCACAATTCAAAGCTGGTCGCGAACACCGGAGATTCATCTGTGAAAGAGATCTTGTAGCCTACTAACAGGGCATATGCCTGTATTTCAGTGA

Full Affymetrix probeset data:

Annotations for 1634750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720