Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634753_at:

>probe:Drosophila_2:1634753_at:268:399; Interrogation_Position=1558; Antisense; GACAGGGCCATTTTGGGCTTGCTCT
>probe:Drosophila_2:1634753_at:487:341; Interrogation_Position=1574; Antisense; GCTTGCTCTGATTGACCTAGGTTGC
>probe:Drosophila_2:1634753_at:721:689; Interrogation_Position=1762; Antisense; TATTCCGATTCGTTGCTGTTACAAT
>probe:Drosophila_2:1634753_at:40:617; Interrogation_Position=1791; Antisense; TGAATTGCTTCGACTAACCGCACAC
>probe:Drosophila_2:1634753_at:384:627; Interrogation_Position=1818; Antisense; TCCACCTCGGATCGCAAAATTCGAA
>probe:Drosophila_2:1634753_at:139:247; Interrogation_Position=1846; Antisense; AATTCTGGAGATTTCGCTCTCCTGT
>probe:Drosophila_2:1634753_at:537:617; Interrogation_Position=1877; Antisense; TGCATAATCAGCTCGGATCCGACGT
>probe:Drosophila_2:1634753_at:512:165; Interrogation_Position=1902; Antisense; AAATCGGAGGCGCAAGTCCAAAACA
>probe:Drosophila_2:1634753_at:197:255; Interrogation_Position=1931; Antisense; CAAAAACAAGAAGTCGCCGGCGATA
>probe:Drosophila_2:1634753_at:376:659; Interrogation_Position=1954; Antisense; TAACCGTCCATCCAACTTATCAATA
>probe:Drosophila_2:1634753_at:632:673; Interrogation_Position=1977; Antisense; TAGCAGATTTTACCAATACCCTCGG
>probe:Drosophila_2:1634753_at:539:27; Interrogation_Position=1992; Antisense; ATACCCTCGGCTATATAATACACGT
>probe:Drosophila_2:1634753_at:561:523; Interrogation_Position=2057; Antisense; GGGCTCAACAGATGTGCCTGAATTT
>probe:Drosophila_2:1634753_at:631:433; Interrogation_Position=2089; Antisense; GAGGTTAACGGCGATCTAATGGGAT

Paste this into a BLAST search page for me
GACAGGGCCATTTTGGGCTTGCTCTGCTTGCTCTGATTGACCTAGGTTGCTATTCCGATTCGTTGCTGTTACAATTGAATTGCTTCGACTAACCGCACACTCCACCTCGGATCGCAAAATTCGAAAATTCTGGAGATTTCGCTCTCCTGTTGCATAATCAGCTCGGATCCGACGTAAATCGGAGGCGCAAGTCCAAAACACAAAAACAAGAAGTCGCCGGCGATATAACCGTCCATCCAACTTATCAATATAGCAGATTTTACCAATACCCTCGGATACCCTCGGCTATATAATACACGTGGGCTCAACAGATGTGCCTGAATTTGAGGTTAACGGCGATCTAATGGGAT

Full Affymetrix probeset data:

Annotations for 1634753_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime