Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634754_at:

>probe:Drosophila_2:1634754_at:509:589; Interrogation_Position=104; Antisense; TGGTTGTCGTTGTCGGCCACTTCAT
>probe:Drosophila_2:1634754_at:180:729; Interrogation_Position=113; Antisense; TTGTCGGCCACTTCATCATCGACAA
>probe:Drosophila_2:1634754_at:679:35; Interrogation_Position=127; Antisense; ATCATCGACAAGCAGCAAGAGCAAG
>probe:Drosophila_2:1634754_at:719:623; Interrogation_Position=14; Antisense; TGCCGCGATTGCGATGCGACGACGT
>probe:Drosophila_2:1634754_at:516:265; Interrogation_Position=187; Antisense; CAGAGGCACAGGCTGTTGGCTAAAA
>probe:Drosophila_2:1634754_at:34:567; Interrogation_Position=191; Antisense; GGCACAGGCTGTTGGCTAAAACAAA
>probe:Drosophila_2:1634754_at:5:159; Interrogation_Position=211; Antisense; ACAAAGCAGAGGACCCGGACCTCGG
>probe:Drosophila_2:1634754_at:691:149; Interrogation_Position=251; Antisense; ACTTGTGTCCTGTGTGTACGTGCTC
>probe:Drosophila_2:1634754_at:402:445; Interrogation_Position=26; Antisense; GATGCGACGACGTTGCTGCCGTGCT
>probe:Drosophila_2:1634754_at:633:595; Interrogation_Position=261; Antisense; TGTGTGTACGTGCTCTGCTCTCACC
>probe:Drosophila_2:1634754_at:4:337; Interrogation_Position=51; Antisense; GCTGCCCCTGATGATGCTGTTATTG
>probe:Drosophila_2:1634754_at:396:447; Interrogation_Position=63; Antisense; GATGCTGTTATTGCTGTTGTTGCTG
>probe:Drosophila_2:1634754_at:350:603; Interrogation_Position=80; Antisense; TGTTGCTGTTGTTGCGTCGTCTCGT
>probe:Drosophila_2:1634754_at:715:327; Interrogation_Position=93; Antisense; GCGTCGTCTCGTGGTTGTCGTTGTC

Paste this into a BLAST search page for me
TGGTTGTCGTTGTCGGCCACTTCATTTGTCGGCCACTTCATCATCGACAAATCATCGACAAGCAGCAAGAGCAAGTGCCGCGATTGCGATGCGACGACGTCAGAGGCACAGGCTGTTGGCTAAAAGGCACAGGCTGTTGGCTAAAACAAAACAAAGCAGAGGACCCGGACCTCGGACTTGTGTCCTGTGTGTACGTGCTCGATGCGACGACGTTGCTGCCGTGCTTGTGTGTACGTGCTCTGCTCTCACCGCTGCCCCTGATGATGCTGTTATTGGATGCTGTTATTGCTGTTGTTGCTGTGTTGCTGTTGTTGCGTCGTCTCGTGCGTCGTCTCGTGGTTGTCGTTGTC

Full Affymetrix probeset data:

Annotations for 1634754_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime