FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634755_at:

>probe:Drosophila_2:1634755_at:118:39; Interrogation_Position=161; Antisense; ATCTGCGAGCGATTCCGATCGACAA
>probe:Drosophila_2:1634755_at:621:177; Interrogation_Position=198; Antisense; AAACGTGGCCCAATACTTTGAGGAT
>probe:Drosophila_2:1634755_at:24:609; Interrogation_Position=216; Antisense; TGAGGATCCGCTTCGATTCCAGCAG
>probe:Drosophila_2:1634755_at:355:351; Interrogation_Position=237; Antisense; GCAGCTCTACCGCAAGATCAGCAAG
>probe:Drosophila_2:1634755_at:11:455; Interrogation_Position=252; Antisense; GATCAGCAAGTTCCAGGCCGACCAG
>probe:Drosophila_2:1634755_at:273:39; Interrogation_Position=282; Antisense; ATCGGACAACCTGGGATTCTATCGC
>probe:Drosophila_2:1634755_at:570:101; Interrogation_Position=332; Antisense; AGAGCCGCTTAAAGGGCTTCTGCAA
>probe:Drosophila_2:1634755_at:568:323; Interrogation_Position=364; Antisense; GCGCAGTTCAACCAGCAGATCCAAA
>probe:Drosophila_2:1634755_at:660:369; Interrogation_Position=393; Antisense; GAAGGAACGGATCGCCGAACTTCGC
>probe:Drosophila_2:1634755_at:75:383; Interrogation_Position=409; Antisense; GAACTTCGCGCCTACATAAAGTACC
>probe:Drosophila_2:1634755_at:577:81; Interrogation_Position=443; Antisense; AGGGTCTCAAGGAGTGGCCACACGC
>probe:Drosophila_2:1634755_at:105:445; Interrogation_Position=556; Antisense; GATGAGCACATGACAACCTTCTGCC
>probe:Drosophila_2:1634755_at:455:317; Interrogation_Position=578; Antisense; GCCTGGACTCGGACATAGATTGCCT
>probe:Drosophila_2:1634755_at:365:721; Interrogation_Position=602; Antisense; TTGAAGAAGACGAACCCCGCCGATA

Paste this into a BLAST search page for me
ATCTGCGAGCGATTCCGATCGACAAAAACGTGGCCCAATACTTTGAGGATTGAGGATCCGCTTCGATTCCAGCAGGCAGCTCTACCGCAAGATCAGCAAGGATCAGCAAGTTCCAGGCCGACCAGATCGGACAACCTGGGATTCTATCGCAGAGCCGCTTAAAGGGCTTCTGCAAGCGCAGTTCAACCAGCAGATCCAAAGAAGGAACGGATCGCCGAACTTCGCGAACTTCGCGCCTACATAAAGTACCAGGGTCTCAAGGAGTGGCCACACGCGATGAGCACATGACAACCTTCTGCCGCCTGGACTCGGACATAGATTGCCTTTGAAGAAGACGAACCCCGCCGATA

Full Affymetrix probeset data:

Annotations for 1634755_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720