Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634758_at:

>probe:Drosophila_2:1634758_at:108:257; Interrogation_Position=1051; Antisense; CACATTGGTGGCGAGGAGTTCCTCC
>probe:Drosophila_2:1634758_at:66:349; Interrogation_Position=1085; Antisense; GCATGATCCTCCTCGATAAGCAGAA
>probe:Drosophila_2:1634758_at:713:407; Interrogation_Position=1167; Antisense; GACGTGCAACCTGGAAACCTATCTG
>probe:Drosophila_2:1634758_at:228:685; Interrogation_Position=1186; Antisense; TATCTGGATTGGTCGGCACGTCTGC
>probe:Drosophila_2:1634758_at:2:285; Interrogation_Position=1207; Antisense; CTGCGTCTGTTTGTCTGCAACGAGA
>probe:Drosophila_2:1634758_at:71:555; Interrogation_Position=1255; Antisense; GGACGCAGTCGAACCGTAGAACTCT
>probe:Drosophila_2:1634758_at:640:359; Interrogation_Position=1313; Antisense; GCAACTACAATAGTGCCACGGCCAT
>probe:Drosophila_2:1634758_at:164:15; Interrogation_Position=1336; Antisense; ATTTTGGAGTCCCTGGAATCGCCGG
>probe:Drosophila_2:1634758_at:294:43; Interrogation_Position=838; Antisense; ATCGTTGCCAGATGTTCCAATTCGC
>probe:Drosophila_2:1634758_at:256:247; Interrogation_Position=856; Antisense; AATTCGCATTTGGAAGCCGCTGTCT
>probe:Drosophila_2:1634758_at:299:599; Interrogation_Position=876; Antisense; TGTCTCCCAAACACTGAGTGCCTTA
>probe:Drosophila_2:1634758_at:244:505; Interrogation_Position=893; Antisense; GTGCCTTACTAAAACGATTGACTGA
>probe:Drosophila_2:1634758_at:129:587; Interrogation_Position=969; Antisense; TGGACCAGAAACTCCACTCAACTGT
>probe:Drosophila_2:1634758_at:465:579; Interrogation_Position=999; Antisense; GGCCACGCAGTACGCACAAATCGTT

Paste this into a BLAST search page for me
CACATTGGTGGCGAGGAGTTCCTCCGCATGATCCTCCTCGATAAGCAGAAGACGTGCAACCTGGAAACCTATCTGTATCTGGATTGGTCGGCACGTCTGCCTGCGTCTGTTTGTCTGCAACGAGAGGACGCAGTCGAACCGTAGAACTCTGCAACTACAATAGTGCCACGGCCATATTTTGGAGTCCCTGGAATCGCCGGATCGTTGCCAGATGTTCCAATTCGCAATTCGCATTTGGAAGCCGCTGTCTTGTCTCCCAAACACTGAGTGCCTTAGTGCCTTACTAAAACGATTGACTGATGGACCAGAAACTCCACTCAACTGTGGCCACGCAGTACGCACAAATCGTT

Full Affymetrix probeset data:

Annotations for 1634758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime