FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634761_at:

>probe:Drosophila_2:1634761_at:497:591; Interrogation_Position=1600; Antisense; TTCCCCAAGGGCATTGTTACGGTCA
>probe:Drosophila_2:1634761_at:300:707; Interrogation_Position=1616; Antisense; TTACGGTCACCTGCTTTGCCTTTGG
>probe:Drosophila_2:1634761_at:262:721; Interrogation_Position=1631; Antisense; TTGCCTTTGGCTATACGAATTTGGT
>probe:Drosophila_2:1634761_at:222:19; Interrogation_Position=1649; Antisense; ATTTGGTATACCCACCGGATATCTT
>probe:Drosophila_2:1634761_at:673:83; Interrogation_Position=1685; Antisense; AGTGGCTGGGCATCTTATTGTATAC
>probe:Drosophila_2:1634761_at:459:519; Interrogation_Position=1723; Antisense; GTGGTCAAGTACATGCTGATCAACT
>probe:Drosophila_2:1634761_at:337:455; Interrogation_Position=1740; Antisense; GATCAACTTGATCGTTTCCATGATG
>probe:Drosophila_2:1634761_at:729:607; Interrogation_Position=1763; Antisense; TGAGGGATCAGATGGCCAGTGTCAA
>probe:Drosophila_2:1634761_at:388:439; Interrogation_Position=1809; Antisense; GAGGCAGCGCATAACATTCTGGCAA
>probe:Drosophila_2:1634761_at:410:11; Interrogation_Position=1824; Antisense; ATTCTGGCAATTCCTGCGCGTTGAA
>probe:Drosophila_2:1634761_at:404:323; Interrogation_Position=1839; Antisense; GCGCGTTGAATATGCCCACTTTATT
>probe:Drosophila_2:1634761_at:77:635; Interrogation_Position=1914; Antisense; TCGCACAGTTGCACAGAACATCCAA
>probe:Drosophila_2:1634761_at:633:553; Interrogation_Position=2052; Antisense; GGAGCGGATCGAGCGAACCTTCACT
>probe:Drosophila_2:1634761_at:268:213; Interrogation_Position=2165; Antisense; AAGACGAGCAGGTTCCAGAGACTGA

Paste this into a BLAST search page for me
TTCCCCAAGGGCATTGTTACGGTCATTACGGTCACCTGCTTTGCCTTTGGTTGCCTTTGGCTATACGAATTTGGTATTTGGTATACCCACCGGATATCTTAGTGGCTGGGCATCTTATTGTATACGTGGTCAAGTACATGCTGATCAACTGATCAACTTGATCGTTTCCATGATGTGAGGGATCAGATGGCCAGTGTCAAGAGGCAGCGCATAACATTCTGGCAAATTCTGGCAATTCCTGCGCGTTGAAGCGCGTTGAATATGCCCACTTTATTTCGCACAGTTGCACAGAACATCCAAGGAGCGGATCGAGCGAACCTTCACTAAGACGAGCAGGTTCCAGAGACTGA

Full Affymetrix probeset data:

Annotations for 1634761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720