FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634763_at:

>probe:Drosophila_2:1634763_at:245:547; Interrogation_Position=1077; Antisense; GGATGTCTTGCTGCGCGGAAAGTTC
>probe:Drosophila_2:1634763_at:520:527; Interrogation_Position=539; Antisense; GGGAAATCCTCGAACAGCGAACAGT
>probe:Drosophila_2:1634763_at:47:461; Interrogation_Position=589; Antisense; GATTCGGAAAAACTAGACCCTCTGC
>probe:Drosophila_2:1634763_at:484:281; Interrogation_Position=608; Antisense; CTCTGCCCTTTCCAGTGATAATTGT
>probe:Drosophila_2:1634763_at:688:441; Interrogation_Position=646; Antisense; GATGTGTTTTCTGGTTTCGATCCTA
>probe:Drosophila_2:1634763_at:563:23; Interrogation_Position=718; Antisense; ATAGGTGGCGCATTGCTGTTCTATT
>probe:Drosophila_2:1634763_at:591:601; Interrogation_Position=734; Antisense; TGTTCTATTCCCAGAAGATGCCCAA
>probe:Drosophila_2:1634763_at:227:435; Interrogation_Position=774; Antisense; GAGGGACACCATTTGTCACTTGGGA
>probe:Drosophila_2:1634763_at:558:649; Interrogation_Position=789; Antisense; TCACTTGGGATTTGGCAGTCCTGCT
>probe:Drosophila_2:1634763_at:408:337; Interrogation_Position=824; Antisense; GCTCTCATGTCGTGGACTTCAATGA
>probe:Drosophila_2:1634763_at:496:259; Interrogation_Position=851; Antisense; CACTGTGCATTTGGTTTGGAACGGA
>probe:Drosophila_2:1634763_at:346:185; Interrogation_Position=886; Antisense; AAAATTGGTGATACTGGCGCCCAAA
>probe:Drosophila_2:1634763_at:581:585; Interrogation_Position=941; Antisense; TGGAAGTACCGCAGCTGCAGCTAGA
>probe:Drosophila_2:1634763_at:228:311; Interrogation_Position=997; Antisense; GCCAAGGACCCTGGTTTCAAGGAGT

Paste this into a BLAST search page for me
GGATGTCTTGCTGCGCGGAAAGTTCGGGAAATCCTCGAACAGCGAACAGTGATTCGGAAAAACTAGACCCTCTGCCTCTGCCCTTTCCAGTGATAATTGTGATGTGTTTTCTGGTTTCGATCCTAATAGGTGGCGCATTGCTGTTCTATTTGTTCTATTCCCAGAAGATGCCCAAGAGGGACACCATTTGTCACTTGGGATCACTTGGGATTTGGCAGTCCTGCTGCTCTCATGTCGTGGACTTCAATGACACTGTGCATTTGGTTTGGAACGGAAAAATTGGTGATACTGGCGCCCAAATGGAAGTACCGCAGCTGCAGCTAGAGCCAAGGACCCTGGTTTCAAGGAGT

Full Affymetrix probeset data:

Annotations for 1634763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720