FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634764_at:

>probe:Drosophila_2:1634764_at:385:323; Interrogation_Position=152; Antisense; GCGCCGTGATGAACTGTGCCGACAA
>probe:Drosophila_2:1634764_at:575:505; Interrogation_Position=167; Antisense; GTGCCGACAACACCGGAGCCAAGAA
>probe:Drosophila_2:1634764_at:697:311; Interrogation_Position=184; Antisense; GCCAAGAACCTGTACGTGATCGCCG
>probe:Drosophila_2:1634764_at:23:515; Interrogation_Position=251; Antisense; GTGTCGGCGACATGTTCGTGGCCAC
>probe:Drosophila_2:1634764_at:496:205; Interrogation_Position=289; Antisense; AAGCCCGAGCTCAGGAAGAAGGTCA
>probe:Drosophila_2:1634764_at:445:221; Interrogation_Position=307; Antisense; AAGGTCATGCCTGCCGTGGTTATTC
>probe:Drosophila_2:1634764_at:528:687; Interrogation_Position=327; Antisense; TATTCGGCAGCGCAAACCGTTCAGG
>probe:Drosophila_2:1634764_at:295:479; Interrogation_Position=36; Antisense; GTTTCCGGCGAACGAATAATCTTGG
>probe:Drosophila_2:1634764_at:132:167; Interrogation_Position=416; Antisense; AAATGAAGGGCTCGGCCATCACTGG
>probe:Drosophila_2:1634764_at:728:225; Interrogation_Position=451; Antisense; AAGGAATGCGCCGATCTGTGGCCCC
>probe:Drosophila_2:1634764_at:599:595; Interrogation_Position=467; Antisense; TGTGGCCCCGTATTGCATCCAATGC
>probe:Drosophila_2:1634764_at:57:347; Interrogation_Position=481; Antisense; GCATCCAATGCAAGCTCTATAGCCT
>probe:Drosophila_2:1634764_at:257:335; Interrogation_Position=494; Antisense; GCTCTATAGCCTAAGGAGTTTCCTT
>probe:Drosophila_2:1634764_at:157:565; Interrogation_Position=59; Antisense; GGAATAACCAGTCCGCGAGCAACAA

Paste this into a BLAST search page for me
GCGCCGTGATGAACTGTGCCGACAAGTGCCGACAACACCGGAGCCAAGAAGCCAAGAACCTGTACGTGATCGCCGGTGTCGGCGACATGTTCGTGGCCACAAGCCCGAGCTCAGGAAGAAGGTCAAAGGTCATGCCTGCCGTGGTTATTCTATTCGGCAGCGCAAACCGTTCAGGGTTTCCGGCGAACGAATAATCTTGGAAATGAAGGGCTCGGCCATCACTGGAAGGAATGCGCCGATCTGTGGCCCCTGTGGCCCCGTATTGCATCCAATGCGCATCCAATGCAAGCTCTATAGCCTGCTCTATAGCCTAAGGAGTTTCCTTGGAATAACCAGTCCGCGAGCAACAA

Full Affymetrix probeset data:

Annotations for 1634764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720