FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634765_at:

>probe:Drosophila_2:1634765_at:536:611; Interrogation_Position=316; Antisense; TGAATGTTTGCCTCGAGGGTCCACT
>probe:Drosophila_2:1634765_at:406:491; Interrogation_Position=372; Antisense; GTAAATGTGACCATGCCGCAGGACT
>probe:Drosophila_2:1634765_at:84:719; Interrogation_Position=418; Antisense; TTCGCTTTGTCACCAAGATCCTGCA
>probe:Drosophila_2:1634765_at:513:39; Interrogation_Position=450; Antisense; ATCGAGTTCATCACGGGCCTGGTCT
>probe:Drosophila_2:1634765_at:514:317; Interrogation_Position=466; Antisense; GCCTGGTCTGCATGAATGTCCTTAA
>probe:Drosophila_2:1634765_at:634:657; Interrogation_Position=488; Antisense; TAAGCAGGCTTGGTCATCCAGCTAT
>probe:Drosophila_2:1634765_at:719:149; Interrogation_Position=523; Antisense; ACATATTCGAAACCTTTCTGCCACA
>probe:Drosophila_2:1634765_at:438:299; Interrogation_Position=596; Antisense; CGCCATCATGAAACACTCGGAGCAA
>probe:Drosophila_2:1634765_at:525:421; Interrogation_Position=615; Antisense; GAGCAACTCTTTCGCGAGCACGTTA
>probe:Drosophila_2:1634765_at:212:355; Interrogation_Position=632; Antisense; GCACGTTATCCTTTGCATGAAGACG
>probe:Drosophila_2:1634765_at:388:129; Interrogation_Position=673; Antisense; ACCTTCCGACGCGACAACTGGTGGA
>probe:Drosophila_2:1634765_at:678:423; Interrogation_Position=708; Antisense; GAGAAACGCTCCTCGGATCTCAGTC
>probe:Drosophila_2:1634765_at:228:453; Interrogation_Position=723; Antisense; GATCTCAGTCTATCCGACCTGCTAA
>probe:Drosophila_2:1634765_at:284:11; Interrogation_Position=825; Antisense; ATTCGGGAGGTCTTTTTTGTGTCTG

Paste this into a BLAST search page for me
TGAATGTTTGCCTCGAGGGTCCACTGTAAATGTGACCATGCCGCAGGACTTTCGCTTTGTCACCAAGATCCTGCAATCGAGTTCATCACGGGCCTGGTCTGCCTGGTCTGCATGAATGTCCTTAATAAGCAGGCTTGGTCATCCAGCTATACATATTCGAAACCTTTCTGCCACACGCCATCATGAAACACTCGGAGCAAGAGCAACTCTTTCGCGAGCACGTTAGCACGTTATCCTTTGCATGAAGACGACCTTCCGACGCGACAACTGGTGGAGAGAAACGCTCCTCGGATCTCAGTCGATCTCAGTCTATCCGACCTGCTAAATTCGGGAGGTCTTTTTTGTGTCTG

Full Affymetrix probeset data:

Annotations for 1634765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720