Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634766_at:

>probe:Drosophila_2:1634766_at:697:169; Interrogation_Position=5022; Antisense; AAAGTTCAGCTAGGCAGGCGTTTTC
>probe:Drosophila_2:1634766_at:452:71; Interrogation_Position=5037; Antisense; AGGCGTTTTCCGCAGTGCCATGTCG
>probe:Drosophila_2:1634766_at:580:505; Interrogation_Position=5051; Antisense; GTGCCATGTCGATGTGGAAGCCCAA
>probe:Drosophila_2:1634766_at:567:457; Interrogation_Position=5089; Antisense; GATAGTGTAATTCCGAACTCTTCTC
>probe:Drosophila_2:1634766_at:385:193; Interrogation_Position=5104; Antisense; AACTCTTCTCTTCGCTAAGCAACAT
>probe:Drosophila_2:1634766_at:296:659; Interrogation_Position=5119; Antisense; TAAGCAACATCCTACACAGTGTGAT
>probe:Drosophila_2:1634766_at:510:21; Interrogation_Position=5142; Antisense; ATATTTAGTGTAACCCAGGCGCGCA
>probe:Drosophila_2:1634766_at:437:269; Interrogation_Position=5157; Antisense; CAGGCGCGCATTTACATTCATTTAA
>probe:Drosophila_2:1634766_at:631:395; Interrogation_Position=5206; Antisense; GAAATCAACTCCTTGGCTAGCACAA
>probe:Drosophila_2:1634766_at:533:357; Interrogation_Position=5225; Antisense; GCACAAGCTGTATATAGTTCTCATT
>probe:Drosophila_2:1634766_at:439:93; Interrogation_Position=5240; Antisense; AGTTCTCATTTAGGATCGTCGCGCT
>probe:Drosophila_2:1634766_at:300:43; Interrogation_Position=5254; Antisense; ATCGTCGCGCTCTATATTGTGTATA
>probe:Drosophila_2:1634766_at:87:661; Interrogation_Position=5345; Antisense; TAAACTAAGAACCAGCCGCAACGCG
>probe:Drosophila_2:1634766_at:515:319; Interrogation_Position=5359; Antisense; GCCGCAACGCGTTAGACTTTAAAAG

Paste this into a BLAST search page for me
AAAGTTCAGCTAGGCAGGCGTTTTCAGGCGTTTTCCGCAGTGCCATGTCGGTGCCATGTCGATGTGGAAGCCCAAGATAGTGTAATTCCGAACTCTTCTCAACTCTTCTCTTCGCTAAGCAACATTAAGCAACATCCTACACAGTGTGATATATTTAGTGTAACCCAGGCGCGCACAGGCGCGCATTTACATTCATTTAAGAAATCAACTCCTTGGCTAGCACAAGCACAAGCTGTATATAGTTCTCATTAGTTCTCATTTAGGATCGTCGCGCTATCGTCGCGCTCTATATTGTGTATATAAACTAAGAACCAGCCGCAACGCGGCCGCAACGCGTTAGACTTTAAAAG

Full Affymetrix probeset data:

Annotations for 1634766_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime