Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634767_at:

>probe:Drosophila_2:1634767_at:422:541; Interrogation_Position=1553; Antisense; GGTTCCTTTGCCGTAATCTACAATT
>probe:Drosophila_2:1634767_at:311:245; Interrogation_Position=1574; Antisense; AATTACTCAGCCGAACTGTTTCCCA
>probe:Drosophila_2:1634767_at:173:299; Interrogation_Position=1665; Antisense; CGCTCATTACATTGCTGGACTCATT
>probe:Drosophila_2:1634767_at:160:681; Interrogation_Position=1688; Antisense; TTTGATCCGAAGATACCGGCCGTGC
>probe:Drosophila_2:1634767_at:454:285; Interrogation_Position=1730; Antisense; CTGATCTCGGGCTTCTGGGTTATGT
>probe:Drosophila_2:1634767_at:341:593; Interrogation_Position=1745; Antisense; TGGGTTATGTTCCTGCCGGAGACAA
>probe:Drosophila_2:1634767_at:378:473; Interrogation_Position=1831; Antisense; GTTCAGTCAGTGTGCTGGTCGCAAA
>probe:Drosophila_2:1634767_at:556:241; Interrogation_Position=1865; Antisense; AATAGCGTATATCCCGACGATCCGG
>probe:Drosophila_2:1634767_at:282:169; Interrogation_Position=1893; Antisense; AAATGGTGCCGCTCAAGAACATCGA
>probe:Drosophila_2:1634767_at:155:727; Interrogation_Position=1945; Antisense; TTGTTTCCCAAGTCCAAAATCCAGC
>probe:Drosophila_2:1634767_at:195:103; Interrogation_Position=1967; Antisense; AGCTTAAATTCCTTGTTACCCTGTG
>probe:Drosophila_2:1634767_at:402:601; Interrogation_Position=1980; Antisense; TGTTACCCTGTGTTTTCTTGTTAAG
>probe:Drosophila_2:1634767_at:427:209; Interrogation_Position=2002; Antisense; AAGAATTCTACTCTTCTGCCTAGTA
>probe:Drosophila_2:1634767_at:264:241; Interrogation_Position=2036; Antisense; AATAGTTTCTATTCATTCCAAGCGA

Paste this into a BLAST search page for me
GGTTCCTTTGCCGTAATCTACAATTAATTACTCAGCCGAACTGTTTCCCACGCTCATTACATTGCTGGACTCATTTTTGATCCGAAGATACCGGCCGTGCCTGATCTCGGGCTTCTGGGTTATGTTGGGTTATGTTCCTGCCGGAGACAAGTTCAGTCAGTGTGCTGGTCGCAAAAATAGCGTATATCCCGACGATCCGGAAATGGTGCCGCTCAAGAACATCGATTGTTTCCCAAGTCCAAAATCCAGCAGCTTAAATTCCTTGTTACCCTGTGTGTTACCCTGTGTTTTCTTGTTAAGAAGAATTCTACTCTTCTGCCTAGTAAATAGTTTCTATTCATTCCAAGCGA

Full Affymetrix probeset data:

Annotations for 1634767_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime