Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634768_at:

>probe:Drosophila_2:1634768_at:464:371; Interrogation_Position=2651; Antisense; GAAGGATCAGATGGCTCCCATGGAG
>probe:Drosophila_2:1634768_at:110:67; Interrogation_Position=2670; Antisense; ATGGAGCTGATACTCACACCTGGTG
>probe:Drosophila_2:1634768_at:216:155; Interrogation_Position=2685; Antisense; ACACCTGGTGGTGCAGAACCCATGT
>probe:Drosophila_2:1634768_at:584:61; Interrogation_Position=2706; Antisense; ATGTCCTTGGTTCAGAGCACTCCAG
>probe:Drosophila_2:1634768_at:713:647; Interrogation_Position=2797; Antisense; TCATCCTGCCCATTTACAAACGCGT
>probe:Drosophila_2:1634768_at:689:707; Interrogation_Position=2810; Antisense; TTACAAACGCGTCTCAACTGCCGAA
>probe:Drosophila_2:1634768_at:130:381; Interrogation_Position=2832; Antisense; GAACCCGCCATGTCTAAGGTGCAAA
>probe:Drosophila_2:1634768_at:152:223; Interrogation_Position=2847; Antisense; AAGGTGCAAACGCTGCCCGTAACGG
>probe:Drosophila_2:1634768_at:286:453; Interrogation_Position=2883; Antisense; GATACAGAAGCGCTGCCGGAAACTG
>probe:Drosophila_2:1634768_at:653:717; Interrogation_Position=2964; Antisense; TTCCGCGCCGATGCCAGCTAAAAAG
>probe:Drosophila_2:1634768_at:506:565; Interrogation_Position=3028; Antisense; GGCAAGGATTATTCACCCACTTAGC
>probe:Drosophila_2:1634768_at:378:683; Interrogation_Position=3093; Antisense; TATCCCACTCATTTGCACCTAGGCA
>probe:Drosophila_2:1634768_at:612:459; Interrogation_Position=3138; Antisense; GATTTCCTAGTTTTATGGCCATTTC
>probe:Drosophila_2:1634768_at:173:477; Interrogation_Position=3198; Antisense; GTTTAGAATTGTTGTTCCGACCAGT

Paste this into a BLAST search page for me
GAAGGATCAGATGGCTCCCATGGAGATGGAGCTGATACTCACACCTGGTGACACCTGGTGGTGCAGAACCCATGTATGTCCTTGGTTCAGAGCACTCCAGTCATCCTGCCCATTTACAAACGCGTTTACAAACGCGTCTCAACTGCCGAAGAACCCGCCATGTCTAAGGTGCAAAAAGGTGCAAACGCTGCCCGTAACGGGATACAGAAGCGCTGCCGGAAACTGTTCCGCGCCGATGCCAGCTAAAAAGGGCAAGGATTATTCACCCACTTAGCTATCCCACTCATTTGCACCTAGGCAGATTTCCTAGTTTTATGGCCATTTCGTTTAGAATTGTTGTTCCGACCAGT

Full Affymetrix probeset data:

Annotations for 1634768_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime